Question

C is equal to the amount of G. Explain why this is 16. Write out the complementary DNA strand for each of the coding DNA stra

0 0
Add a comment Improve this question Transcribed image text
Answer #1

16.

a. 5' ATGCGATAGCCGATAAAAGACTTG 3'-

3' TACGCTATCGGCTATTTTCTGAAC 5'

RNA-  5' AUGCGAUAGCCGAUAAAAGACUUG 3'-

mRNA-  5' AUGUAGCCGAUAAAAUUG 3

B. 5' CGTACGTAGCGAGGCAATTGGGGG 3'

3' GCATGCATCGCTCCGTTAACCCCC5'

RNA- 5' CGUACGUAGCGAGGCAAUUGGGGG 3'

mRNA- 5' CGUACGGGCAAUUGGGGG 3'

C.  5' CGATTATGAGATCATTGGCCCATG 3'

3' GCTAATACTCTAGTAACCGGGTAC 5'

RNA-  5' CGAUUAUGAGAUCAUUGGCCCAUG 3'

mRNA-  5' CGAUUAUGAGAUUGGAUG 3'

Add a comment
Know the answer?
Add Answer to:
C is equal to the amount of G. Explain why this is 16. Write out the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....

    Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...

  • In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....

    In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • Please help with 1-16!!! (two pictures are attached) Thanks! Transcription . Although both prokaryotes and eukaryotes...

    Please help with 1-16!!! (two pictures are attached) Thanks! Transcription . Although both prokaryotes and eukaryotes put a cap and a tail on the mRNA, only eukaryotes have introns that have to be spliced out. (T/F) 2. The poly A tail on cukaryotic mRNA protects the RNA from rapid degradation in the cytoplasm. (T/F) 3. The polyA tail is added to eukaryotic mRNA immediatel after transport of the message from the nucleus. (T/F) 4. is usually a single stranded molecule....

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...

    PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the answers below. (Select more than 1 answer) The coding strand is the first strand running from 5' to 3'. The coding strand is the second strand running from 3' to 5'. The template strand is the second strand running from 3' to 5'. The template strand is the first strand running from 5' to 3'. 2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...

  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3P-A TIGOTTACTTGCA T-5° DNA 5'- 2) Does it matter which strand is the 'code strand"? The following two sequences look identical, except one runs 3'-5' and the other 5'-3'. For...

  • INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using...

    INSTRUCTIONS You may print out this assignment and fill it in by hand. We suggest using pencil in case you make mistakes!! Submit your Assignment as a single doc on Canvas. ASSIGNMENT 1) For the DNA sequence given below, write the complementary DNA sequence that would complete the double-strand. DNA 3-A TTGCT TACTTGCA T-5° DNA 5 2) Does it matter which strand is the 'code strand'? The following two sequences look identical, except one runs 3-5' and the other 5'-3'....

  • .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A...

    .Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...

  • 3. Translation. According to the rules of the genetic code, there are six different reading frames...

    3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT