Question

The primary database where investigators submit DNA sequences to NCBI is Uniprot Genbank RefSeq PubMed

The primary database where investigators submit DNA sequences to NCBI is

Uniprot
Genbank
RefSeq
PubMed
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer:Genbank

Genbank devloped in 1992 started collection of genes and maintain genebank from each laboratories. These all services were processed through the website by NCBI Home page.

Add a comment
Know the answer?
Add Answer to:
The primary database where investigators submit DNA sequences to NCBI is Uniprot Genbank RefSeq PubMed
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Find the human BRCA1 gene transcript mRNA using NCBI refseq database.(hint: accession NM_007299.) (a) What is...

    Find the human BRCA1 gene transcript mRNA using NCBI refseq database.(hint: accession NM_007299.) (a) What is the GI number of the protein? (b) What is the length of the mRNA sequence? (c) Write down the mRNA sequence as it is shown on the database. (d) Also find and write the sequence in FASTA format. (e) How many of each of the four nucleotides A, C, T and G, are there in the genome? (f) How many occurrences of the DNA...

  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...

    Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...

  • genetic questions 25. Trinucleotide repeat regions in DNA sequences where the repeat region can hydrogen bond...

    genetic questions 25. Trinucleotide repeat regions in DNA sequences where the repeat region can hydrogen bond into a single-stranded stem-loop structure often lead to mutations. a. Frameshift b. Transition c. Transversion d. Base substitution 26. The following graph shows two very similar populations: population a and population b. Assuming all else is equal between these populations aside from what is in the graphs, which population's trait value (i.e., phenotype for a particular trait) would you expect to change over time...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT