A geneticist has studied the sequence of a gene in each of three species, A, B, and C. Species A and species B are sister species; species C is more distantly related. The geneticist has calculated the ratio of nonsynonymous (NS) to synonymous (S) nucleotide substitutions in the coding region of the gene in two ways—first, by comparing the gene sequences of species A and C, and second, by comparing the gene sequences of species B and C. The NS:S ratio for the comparison of species B and C is five times greater than it is for the comparison of species A and C. What might this difference in the NS:S ratios suggest?
A geneticist has studied the sequence of a gene in each of three species, A, B,...
Question 6 0 / 1 pts Imagine two species that differ in amino acid sequence at a particular locus. The nucleotide diversity for nucleotide sites with synonymous changes equals 0.025 and that for sites with nonsynonymous changes equals 0.01. If there are 8 substitutions at synonymous sites and 4 substitutions at nonsynonymous sites, calculate both the dn/ds ratio and the ratio of the McDonald-Kreitman test . Do the two ratios lead to different conclusions with respect to the nature of...
You identify a gene (gene 1) in once species (species 1) that shares significant homology to a gene (gene 2) in a second species (species 2). Species 1 and species 2 share a common ancestor. Gene 1 and Gene 2 lie within in blocks of sequences that show synteny between the two species. You determine the number and identity of synonymous and non-synonymous sequence changes in the coding sequences when comparing the two genes. From these data alone (i.e., without...
The images below is DNA sequence (in reading frame) and the amino add translation far a region of a protein coding gene for two species you are researching. By comparing the two alignments and or using the translation table provided (remember U = T) mark all of the mutations in the DNA alignment as either non-synonymous (N) or synonymous (S). Place either an "N" or an "S" in the space above the mutation in the DNA alignment. How many non-synonymous...
A new gene is discovered. Its sequence has a significant similarity to the sequences of known Toll Like Receptor (TLR). You then decide to investigate its properties. Which of the following experiments would allow you to test if the gene indeed functions as a TLR and is important in pathogen detection? Give your reasoning for selecting a particular strategy. a) A NF-kB knockout mouse. Antibody staining to evaluate the production of cytokines and antimicrobial peptides, compared to the wild type...
Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...
onaformation from a ee is used in the synthesisof 17 functional gene product. A) Geno B) Gene regulation C) Epigenetics D) Imprinting E) Chromatin remodeling 18. A histone code is the: A) B) nucleotide sequence of an individual histone protein's gene. pattern of chemical modification of the DNA wrapped around an individual histone. C) D) E) pattern of chemical modification of the histone tails. number of amino acids in an individual histone that are methylated None of the other answer...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
A gene in species A has an orthologous counterpart in species B. When the two genes are compared, a total of eight base- pair differences are found. The fossil record indicates that the last common ancestor of A and B lived 60 million years ago. What is the average rate at which base-pair mutations accumulate in these orthologous genes? One base-pair change every Select one: a. 10 million years O b. 2 million years O c. 20 million years O...
genetic biology
5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond? After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...