Homework Answers
N-MIKE-C
N- Met- Ile- Lys-Glu- C
N- AUG/- AUU,AUC,AUA/- AAA, AAG/- GAA,GAG-C
So the correct answer is, b, 5'- AUG-AUU-AAA-GAA-UGA-3'
UGA is stop codon which doesnt code for any amino acid. It is a termination codon.
Add Answer to:
Which of the following mRNA sequences could have code for the polymer N-MIKE-C (one letter code)...
Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points...
Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points out of 2.50 Select one: a. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral RNA P Flag question O b. CRISPR-Cas system uses an RNA-directed nuclease to degrade viral DNA C. CRISPR-Cas system uses a RNA-directed nuclease to degrade viral RNA O d. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral DNA e. CRISPR-Cas is a defense mechanism in eukaryotes against viral...
The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains...
The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains the information needed to code for a peptide? Why? i: 5’ UUUGCUAAAGACCUAGAAUU 3’ ii: 5’ CCUCCAUGCCGCUAUACUUA 3’ iii: 5’ CAUGUAACCGCUCGAGGAUA 3’ iv: 5’ AACCUUCUUAGAGGCCCCUA 3’
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences,...
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here a) m RN A: 5-CCGCACGGAUAU-3' amino acid sequence: b) mRNA: 5-GGCAACGAGCUC-3' amino acid sequence: c) mRNA: 5'-CAACGUAAUC GA-3' amino acid sequence: Hint O Previous ® Give Up & View Solution 2 Answer Next Ext Check
Which process necessarily involves recognition of specific RNA sequences? Select one: a. Intron removal by mRNA...
Which process necessarily involves recognition of specific RNA sequences? Select one: a. Intron removal by mRNA splicing. b. Association of the ribosome 30s subunit with mRNA for the initiation of translation. c. Termination of translation. d. All of these e. None of these
2.Base changes in which of the following can have evolutionary sequences? -Non-coding RNA -mRNA -Promoter sequences...
2.Base changes in which of the following can have evolutionary sequences? -Non-coding RNA -mRNA -Promoter sequences -Protein coding gene -Cis-regulatory module
Which of the following is a synthetic polymer? Select one: a. cellulose O b. polyisoprene C....
Which of the following is a synthetic polymer? Select one: a. cellulose O b. polyisoprene C. DNA d. poly(hexamethyleneadipamide) e. enzymes
Which of the following is a natural polymer? Select one: O a. Rubber b. Polyester c....
Which of the following is a natural polymer? Select one: O a. Rubber b. Polyester c. Silk d. Rubber & polyester e. Rubber & silk
Which of the following eukaryotic mRNA 5' untranslated sequences is likely to interfere with translation initiation?...
Which of the following eukaryotic mRNA 5' untranslated sequences is likely to interfere with translation initiation? A) 5'-AUAUAGAAAAUAACGCUUAUUAAUUCUUUGAAUG B) 5'-CGUUACAAAAUAACGCAUUUCCAAUUCUUUGAAUG C) 5-AUAUAGAAAAUAACGCAUUUCCAAUUCUUUGAAUG
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
1. Amino acids have both a three letter, and a one letter code, for example the...
1. Amino acids have both a three letter, and a one letter code, for example the amino acid Glycine is “Gly” or “G.” There are 20 single letter codes for amino acids, which is almost an entire alphabet. (skip any letters without a corresponding amino acid) it would make. A. For example: “Ryan Smith”, would be: “Arginine, Tyrosine, Alanine, Asparagine, Serine, Methionine, Isoleucine, Threonine, Histidine” B. Take this sequence of amino acids, and write out a sequence of RNA that could...
Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points out of 2.50 Select one: a. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral RNA P Flag question O b. CRISPR-Cas system uses an RNA-directed nuclease to degrade viral DNA C. CRISPR-Cas system uses a RNA-directed nuclease to degrade viral RNA O d. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral DNA e. CRISPR-Cas is a defense mechanism in eukaryotes against viral...
Question 7 of 7 Map deb A pling Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. A link to a table of codons can be found here a) m RN A: 5-CCGCACGGAUAU-3' amino acid sequence: b) mRNA: 5-GGCAACGAGCUC-3' amino acid sequence: c) mRNA: 5'-CAACGUAAUC GA-3' amino acid sequence: Hint O Previous ® Give Up & View Solution 2 Answer Next Ext Check
Which of the following is a synthetic polymer? Select one: a. cellulose O b. polyisoprene C. DNA d. poly(hexamethyleneadipamide) e. enzymes
Which of the following is a natural polymer? Select one: O a. Rubber b. Polyester c. Silk d. Rubber & polyester e. Rubber & silk
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago