The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains...
The following sequences represent the beginning of potential mRNA molecules. Which one of these strands contains the information needed to code for a peptide? Why?
i: 5’ UUUGCUAAAGACCUAGAAUU 3’
ii: 5’ CCUCCAUGCCGCUAUACUUA 3’
iii: 5’ CAUGUAACCGCUCGAGGAUA 3’
iv: 5’ AACCUUCUUAGAGGCCCCUA 3’
Homework Answers
I believe the correct answers to be as follows:
Option ii) 5’ CCUCCAUGCCGCUAUACUUA 3’
Because both of these sequence have AUG codon that is a start codon and is needed by the ribosome to start the production of peptide. Option C can not be correct because it has UAA codon or stop codon next to AUG codon so the translation would stop right here and no peptide would be synthesized.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
Add Answer to:
The following sequences represent the beginning of
potential mRNA molecules. Which one of these strands contains...
Which of the following mRNA sequences could have code for the polymer N-MIKE-C (one letter code)...
Which of the following mRNA sequences could have code for the polymer N-MIKE-C (one letter code) Select one: a. 5'-AUGAUCAAGUGA-3 b. 5-AUGAUUAAAGAAUGA-3' c. 5-AUGAUUAAGGAC-3 d. 5-AGUAAGAAAUAAGAU-3' ОО e. 5-AUUAAGGAAUGA-3
Which of the following correctly describes the process of Translation? I. tRNA anticodon bonds to mRNA...
Which
of the following correctly describes the process of
Translation?
I.
tRNA anticodon bonds to mRNA codon
II.
Ribosome bonds to mRNA strand
II.
Ribosome reaches a STOP codon and detaches from the mRNA
IV.
Each tRNA adds an Amino Acid to the chain as the Ribosome moves
along
the mRNA
V.
Complimentary mRNA strand is made from DNA template
OA. V, I, IV, III B. II, IV, III, I, V C. II, I, IV, III D. V, II, I,...
Which of the following correctly matches the molecules to the names of the functional group? I....
Which of the following correctly matches the molecules to the names of the functional group? I. CH3OCH3 Ether II. CH3CONH2 Amine III. CHESH Thiol IV. CH3CHO Alcohol Select one: 0 a. I and II b. III and IV c. II and III d. I and III Which of the following correctly matches the molecules to the names of the functional group? I. CH3NH2 Amide II. CHESCH; Sulfide III. CH3CONH2 Amine IV. CH3CO,CH3 Ester Select one: a. III and IV b....
Which of the following structures contains a primary amine? NH2 NH NH2 IV Select one: а....
Which of the following structures contains a primary amine? NH2 NH NH2 IV Select one: а. b. II c. IV d. I Which of the following structures contains a secondary amine NH2 NH NH2 IV II Select one: a. IV b. II c. I d. IlIl Which of the following structures contains an alkene? II IV Select one: а. I b. IV c. III d.I Which of the following structures contains an amide? NH2 NH NH2 IV Select one: а....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand during DNA replication? I. DNA ligase II. Okazaki fragments III. lagging strand IV. leading strand V. RNA polymerase O I, II, III O I, II, III, V O II, IV, V O I, II, IV, V O II, III, V 4 pts Question 26 4 pts Which of the following aids in recruitment of RNA polymerase to a promoter of a gene to initiate...
Which of the following mRNA strands contains the longest open reading frame? A.5′-CCACGAUGCGUUGAGCGC-3′[16%] B.5′-CAAUGGUAAAGUCUUAGU-3′[51%] C.5′-GACGAUGUAACUUGCACU-3′[8%] D.5′-AGAAUGGUAUCCUGAGCC-3′[2...
Which of the following mRNA strands contains the longest open reading frame? A.5′-CCACGAUGCGUUGAGCGC-3′[16%] B.5′-CAAUGGUAAAGUCUUAGU-3′[51%] C.5′-GACGAUGUAACUUGCACU-3′[8%] D.5′-AGAAUGGUAUCCUGAGCC-3′[2 The correct answer is B because there is the largest distance between the start codon and stop codon. I get that. What I don't get is that these strands are written from 5' to 3'. I know that this is the convention, but I thought that DNA was read from 3' to 5' by the enzymes that synthesize the new strand? What am I...
21) Consider the following structures I-IV. Circle the two species that represent resor sonance structures H....
21) Consider the following structures I-IV. Circle the two species that represent resor sonance structures H. O: :0: H .H N. N: 22) Circle the base and the conjugate base in the following reaction но CH,COO CH COOH HO IV ш II Chapter 3 particular molecule? 23) Why do z bonds confer reactivity on a A) Because n bonds are diffficult to break in chemical reactions. B) Because z bonds make a molecule an acid. C) Because z bonds are...
You have a segment of mRNA that contains the following sequence: 5-ALAGGCAUUCGAUCCGGAUAGCAU-3'. Which of the following...
You have a segment of mRNA that contains the following sequence: 5-ALAGGCAUUCGAUCCGGAUAGCAU-3'. Which of the following ONA molecules would be the template strand from which this segment of mRNA was produced? 3-TATCCGTAAGCTAGGCCTATCGTA 5 3'-TACGATAGGCCTAGCTTACGGATAS 3 AUCGUAUCCGGAUCGAUGCCUAUS none of the above
Please solve Which of the following molecules contains the most chemical potential energy? ADP AMP ATP...
Please solve
Which of the following molecules contains the most chemical potential energy? ADP AMP ATP Adenosine Why is the shape of enzyme activity as a function of temperature shaped like a shark fin and declines above a certain temperature? substrate molecules slow down as temperature increases DNA cannot form hydrogen bonds at high temperatures the enzyme structure is denatured by heat and cannot bind the substrate. the amino acid sequence of the protein changes with heat. You are hired...
Which of the following mRNA sequences could have code for the polymer N-MIKE-C (one letter code) Select one: a. 5'-AUGAUCAAGUGA-3 b. 5-AUGAUUAAAGAAUGA-3' c. 5-AUGAUUAAGGAC-3 d. 5-AGUAAGAAAUAAGAU-3' ОО e. 5-AUUAAGGAAUGA-3
Which
of the following correctly describes the process of
Translation?
I.
tRNA anticodon bonds to mRNA codon
II.
Ribosome bonds to mRNA strand
II.
Ribosome reaches a STOP codon and detaches from the mRNA
IV.
Each tRNA adds an Amino Acid to the chain as the Ribosome moves
along
the mRNA
V.
Complimentary mRNA strand is made from DNA template
OA. V, I, IV, III B. II, IV, III, I, V C. II, I, IV, III D. V, II, I,...
Which of the following correctly matches the molecules to the names of the functional group? I. CH3OCH3 Ether II. CH3CONH2 Amine III. CHESH Thiol IV. CH3CHO Alcohol Select one: 0 a. I and II b. III and IV c. II and III d. I and III Which of the following correctly matches the molecules to the names of the functional group? I. CH3NH2 Amide II. CHESCH; Sulfide III. CH3CONH2 Amine IV. CH3CO,CH3 Ester Select one: a. III and IV b....
Which of the following structures contains a primary amine? NH2 NH NH2 IV Select one: а. b. II c. IV d. I Which of the following structures contains a secondary amine NH2 NH NH2 IV II Select one: a. IV b. II c. I d. IlIl Which of the following structures contains an alkene? II IV Select one: а. I b. IV c. III d.I Which of the following structures contains an amide? NH2 NH NH2 IV Select one: а....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Question 25 4 pts Which of the following terms are associated with the discontinuously replicated strand during DNA replication? I. DNA ligase II. Okazaki fragments III. lagging strand IV. leading strand V. RNA polymerase O I, II, III O I, II, III, V O II, IV, V O I, II, IV, V O II, III, V 4 pts Question 26 4 pts Which of the following aids in recruitment of RNA polymerase to a promoter of a gene to initiate...
21) Consider the following structures I-IV. Circle the two species that represent resor sonance structures H. O: :0: H .H N. N: 22) Circle the base and the conjugate base in the following reaction но CH,COO CH COOH HO IV ш II Chapter 3 particular molecule? 23) Why do z bonds confer reactivity on a A) Because n bonds are diffficult to break in chemical reactions. B) Because z bonds make a molecule an acid. C) Because z bonds are...
You have a segment of mRNA that contains the following sequence: 5-ALAGGCAUUCGAUCCGGAUAGCAU-3'. Which of the following ONA molecules would be the template strand from which this segment of mRNA was produced? 3-TATCCGTAAGCTAGGCCTATCGTA 5 3'-TACGATAGGCCTAGCTTACGGATAS 3 AUCGUAUCCGGAUCGAUGCCUAUS none of the above
Please solve
Which of the following molecules contains the most chemical potential energy? ADP AMP ATP Adenosine Why is the shape of enzyme activity as a function of temperature shaped like a shark fin and declines above a certain temperature? substrate molecules slow down as temperature increases DNA cannot form hydrogen bonds at high temperatures the enzyme structure is denatured by heat and cannot bind the substrate. the amino acid sequence of the protein changes with heat. You are hired...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago