Question

Which of the following mRNA strands contains the longest open reading frame? A.5′-CCACGAUGCGUUGAGCGC-3′[16%] B.5′-CAAUGGUAAAGUCUUAGU-3′[51%] C.5′-GACGAUGUAACUUGCACU-3′[8%] D.5′-AGAAUGGUAUCCUGAGCC-3′[2...

Which of the following mRNA strands contains the longest open reading frame?

A.5′-CCACGAUGCGUUGAGCGC-3′[16%]

B.5′-CAAUGGUAAAGUCUUAGU-3′[51%]

C.5′-GACGAUGUAACUUGCACU-3′[8%]

D.5′-AGAAUGGUAUCCUGAGCC-3′[2

The correct answer is B because there is the largest distance between the start codon and stop codon. I get that. What I don't get is that these strands are written from 5' to 3'. I know that this is the convention, but I thought that DNA was read from 3' to 5' by the enzymes that synthesize the new strand? What am I missing? Thank you

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer to this questions is definately "B"  as rightly explained in question itself that "there is the largest distance between the start codon and stop codon."

I assume there is bit of confusion between the process of replication and translation-

In replication or in sythesis of new DNA strands, as rightly mentioned in question itself that "the DNA template is read in 3′ to 5′ direction by the enzymes whereas a new strand is synthesized in the 5′ to 3′ direction".

But in the process of translation, in mRNA reading frame codon are always translated in the 5′→3′ direction into amino acids by a ribosome to produce a polypeptide chain

And Open reading frame is only and only related to translation where it decides which nucleotide to start translation, and when to stop.

Add a comment
Know the answer?
Add Answer to:
Which of the following mRNA strands contains the longest open reading frame? A.5′-CCACGAUGCGUUGAGCGC-3′[16%] B.5′-CAAUGGUAAAGUCUUAGU-3′[51%] C.5′-GACGAUGUAACUUGCACU-3′[8%] D.5′-AGAAUGGUAUCCUGAGCC-3′[2...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 7. Open reading frames A protein coding gene includes the following sequence on one of its...

    7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...

  • Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences...

    Fill in the complementary base pairs for the strand below STACGCCCATTI TAGA ATTGCGTGGGCATTAAGTTTTA TACC3 DNA sequences 3' I Find and put a square around the TATA box (promoter) in the double stranded DNA above Find and circle the terminator sequence (GGGCG) in one of the strands above The strand with promoter and terminator is the strand of interest: using the template strand, synthesize an mRNA sequence mRNA molecule in the boxes below; pay attention to polarity 53: Find and circle...

  • Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU -...

    Original DNA & mRNA: DNA template: 3' - GGGTACGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAUGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' What effect would the following DNA mutation have on the polypeptide synthesized from the gene? DNA template: 3' - GGGTTCGGCTCTAAA(300b)TACCCGATCGTA - 5' mRNA: 5' - CCCAAGCCGAGAUUU(300b)AUGGGCUAGCAU - 3' There will be no effect because the codon still calls for the same amino acid. The polypeptide's synthesis will stop too soon because a stop codon has been introduced too early in the sequence. A...

  • 1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or...

    1.) In which direction is RNA transcribed?    2.) Which of the two strands (A or B) serves as the TEMPLATE strand for the transcription of a mRNA that contains both a start and a stop codon?    3.) Which number (1, 2, 3, 4, or 5) best approximates the location of the -10 consensus sequence?    4.) How many amino acids long is the protein encoded by the mRNA from this DNA sequence?    5.) What is the second...

  • 3. Translation. According to the rules of the genetic code, there are six different reading frames...

    3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...

  • The following is a small stretch of DNA sequence from middle of a bacterial open reading...

    The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length :      5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’      3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...

  • Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...

    Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...

  • Which of the following are usually located in the "open reading frame" of a gene (CHeck...

    Which of the following are usually located in the "open reading frame" of a gene (CHeck all that apply) exons promoter start codon 5'-UTR introns polyadenylation signal a frameshift mutation 3'-UTR

  • I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

    I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...

  • 1. Which of the following statements about the flow of genetic information is true? a. Proteins...

    1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT