Question

Which of the following are usually located in the "open reading frame" of a gene (CHeck...

Which of the following are usually located in the "open reading frame" of a gene (CHeck all that apply)

exons

promoter

start codon

5'-UTR

introns

polyadenylation signal

a frameshift mutation

3'-UTR

0 0
Add a comment Improve this question Transcribed image text
Answer #1

An open reading frame of a gene is the part of gene from the START codon which is TAC in DNA and to the termination codon. This termination codon is for translation meanwhile UTR are transcribed further downstream than the stop codon.

So that's why Promoter, UTRs on both side aren't part of a ORF. Meanwhile both Introns and Exons are part of a ORF as they are transcribed and lies between a Start and Stop codon. Any frameshift mutation in the gene will also be a part of an ORF as this mutation will change the frame of translation thus it is in an exon.

So the right options are :-

Exons

Start codon

Intron

A frameshift mutation

Add a comment
Know the answer?
Add Answer to:
Which of the following are usually located in the "open reading frame" of a gene (CHeck...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Place the following mutations, all within the same codon in the open reading frame of a...

    Place the following mutations, all within the same codon in the open reading frame of a gene, in order from MOST likely to LEAST likely to eliminate the function of the encoded protein. A. A transition mutation in the second position of the codon. B. A transversion mutation in the third position of the codon. C. A transition mutation in the third position of the codon. D. A deletion of one base from the third position of the codon Be...

  • 7. Open reading frames A protein coding gene includes the following sequence on one of its...

    7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...

  • B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter...

    B. (10pts) Gene expression can be regulated in many ways. In the gene below, each letter represents a different mutation. Indicate which mutation would: (Use each letter only once.) trigger non-sense mediated decay increase transcript stability result in aberrant splicing reduce mRNA expression levels alter ADAR RNA editing promoter D — transcribed region intron A intron E exon- transcription factor binding sites exon spliced mRNA T 5'UTR CDS 3'UTR start codon stop codon C. (8pts) UAU encodes the amino acid...

  • I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

    I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...

  • Question 10 0.25 pts Which of the following is true of snRNPs? They bind to the...

    Question 10 0.25 pts Which of the following is true of snRNPs? They bind to the TATA box of the promoter region of a gene. They bind to splice sites at each end of the exon. They join together to form a large structure called the spliceosome. They act only in the cytosol. They attach introns to exons in the correct order. Question 11 0.25 pts Which of the following types of mutation, resulting in an error in the mRNA...

  • 6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...

    6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...

  • Using the standard genetic code, find and translate an open reading frame that begins with a...

    Using the standard genetic code, find and translate an open reading frame that begins with a start-codon and ends with a stop-codon in the following DNA sequence: ACCCATGGACTTTCAGTGAAAC

  • Below is a diagram of a transcription unit and the mRNA made from the transcription unit:...

    Below is a diagram of a transcription unit and the mRNA made from the transcription unit: A H TTGACA DNA TATAAT -35 B -10 С D - Start codon Stop codon mRNA 5' 3' E F G Is this a prokaryotic or eukaryotic transcription unit? prokaryotic What is the name of the cofactor required for RNA polymerase to bind to the promoter? Which letters on the above diagram correspond to the following structures? Promoter Pribnow box Non-template strand Transcriptional start...

  • 1) Suppose that gene A 3,000 bp. Suppose that g contained within intron 1 opposite directions...

    1) Suppose that gene A 3,000 bp. Suppose that g contained within intron 1 opposite directions for the two genes. covers 10,000 base pairs (bp) and has 2 exons; the intron in gene A is ene B covers 1,500 bp and has two exons. Gene B is completely of gene A. The direction of the transcriptional bubble moves in A. Draw the genomic organization (i.e., exons and introns) of gene A AND gene B. Label the polarity of the DNA...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT