Place the following mutations, all within the same codon in the open reading frame of a gene, in order from MOST likely to LEAST likely to eliminate the function of the encoded protein.
A. A transition mutation in the second position of the codon.
B. A transversion mutation in the third position of the codon.
C. A transition mutation in the third position of the codon.
D. A deletion of one base from the third position of the codon
Be sure to explain how and why you ordered them the way you did. Define any key terms along the way and provide diagrams to simply your explanations if necessary. There should explanation for all the mutations as you order them




Place the following mutations, all within the same codon in the open reading frame of a...
1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5-Bromouracil such that mutations were induced at Trp codons. Would you expect that these mutations would results in a non-sense mutation, a silent mutation, a missense mutation. Explain your answer.What is a tautomeric shift and explain how it contributes to transition mutations? 2.Draw the structure of the rare tautomeric enol form of guanine. Draw the structure of the monophosphate deoxynucleotide which...
Which of the following are usually located in the "open reading frame" of a gene (CHeck all that apply) exons promoter start codon 5'-UTR introns polyadenylation signal a frameshift mutation 3'-UTR
Which of the following mutations could result in a truncated protein? Choose all that apply. A missense mutation that changes a phenylalanine to a leucine O A two base pair frameshift O An in-frame removal of three base pairs O A one base pair frameshift A chromosomal-level deletion O o A chromosomal-level insertion O A nonsense mutation that changes a cysteine to a stop codon
Please provide justifications for all answers so I
understand. Extra detail is very helpful. Thank you so
much.
Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...
The images below is DNA sequence (in reading frame) and the amino add translation far a region of a protein coding gene for two species you are researching. By comparing the two alignments and or using the translation table provided (remember U = T) mark all of the mutations in the DNA alignment as either non-synonymous (N) or synonymous (S). Place either an "N" or an "S" in the space above the mutation in the DNA alignment. How many non-synonymous...
1) Which of the following mutations could result in a frameshift? A) a base insertion B) a base deletion C) a base substitution D) either A or B E) A, B, and C 2) Which of the following point mutations would be most likely to result in a non-functioning protein? A) a single base substitution in an intron B) a single base deletion near the end of the coding sequence C) a single base deletion in the codon following the...
Identify the correct statements about mutations. Choose all that apply. A. An individual with PKU would need to take a supplement of phenylalanine since they are missing the enzyme that synthesizes phenylalanine from metabolic precursors. The number of mutations resulting from the incorporation of incorrect bases during DNA replication is reduced through the use of a 3'-51 exonuclease. Cells with wild-type copies of CFTR are likely to have a lower concentration of Cl- than cells with mutated copies of CFTR....
please answer all 6 questions
Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...