A piece of DNA that is 3 kb in length is found in many locations throughout...
A piece of DNA that is 3 kb in length is found in many locations throughout the genome. How would you decide whether this was a LINE or a DNA transposon?
| a. |
If it is transcribed, then it must be a LINE; if not, then it is a DNA transposon. |
|
| b. |
If it has more than 10,000 copies in the genome, it is a LINE; if not, it is a DNA transposon. |
|
| c. |
If it uses an RNA intermediate, it is a LINE; if not, it is a DNA transposon. |
|
| d. |
If it has more than 10,000 copies in the genome, it is a DNA transposon; if not, it is a LINE. |
|
| e. |
If it contains the sequence GCTCGATC it is a LINE; if not, it is a DNA transposon. |
Homework Answers
Add Answer to:
A piece of DNA that is 3 kb in length is found in many locations
throughout...
1. Viruses are a. cells containing DNA and protein. b. larger than most bacteria. c. acellular....
1. Viruses are a. cells containing DNA and protein. b. larger than most bacteria. c. acellular. d. able to take in nutrients and expel wastes. e. mutated forms of DNA. 2. Beginning with a single bacterium, how many cells would be present after 4 hours of growth if they can double every 20 minutes? a. 12 b. 24 c. 64 d. 4,096 e. 34,217,728 3. The genetic information of viruses can be a. DNA. b. RNA. c. single-stranded. d. double-stranded....
Classify each statement as to whether it represents a piece of evidence that supports the endosymbiont...
Classify each statement as to whether it represents a piece of evidence that supports the endosymbiont theory of the evolution of mitochondria and chloroplasts from prokaryotes. Some organellar genes have migrated to the nucleus. Evidence for the endosymbiont theory Does not support endosymbiont theory Some organelle proteins are encoded in the nucleus. Organelles do not have flagella. Mitochondrial rRNA genes are most similar to the rRNA gene of a bacterium. Organelle translation is inhibited by antibiotics that inhibit prokaryotic translation...
Could you please provide me the answer for following multiple choice question- subject- Genes, Genomics and...
Could you please provide me the answer for following multiple choice question- subject- Genes, Genomics and Human Health( Genetics) Question-2 Question 2.1 Whole genome DNA sequencing can be applied to genome-wide association studies to sequence the genomes of as many as 100,000 individuals search for rare Mendelian coding mutations search for very rare variants on haplotypes identified in genome-wide genotyping studies identify family pedigrees in large populations Question 2.2 Next Generation sequencing aims to sequence the genome to a coverage...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things:...
In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things: (1) create and maintain a national DNA database, and (2) establish standards for forensic DNA testing. Because the human genome is full of DNA tandem repeats and because they vary in the number of contiguous repeat units, it was decided to use tandem repeats to build the DNA database. In 1996, 13 loci were chosen to be the core short tandem repeats (STR) for...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
You decide to make a construct that places the DNA between the genes upstream to a...
You decide to make a construct that places the DNA between the
genes upstream to a reporter gene (GFP) in place of Gene 1. The
full-length construct has the correct expression pattern in
antennal discs. You then create several constructs that delete
sections of the upstream DNA and score them for expression. The
seven constructs are shown below; the black bars indicate the
region(s) deleted in each construct. The data table on the right
shows the expression results for each...
Classify each statement as to whether it represents a piece of evidence that supports the endosymbiont theory of the evolution of mitochondria and chloroplasts from prokaryotes. Some organellar genes have migrated to the nucleus. Evidence for the endosymbiont theory Does not support endosymbiont theory Some organelle proteins are encoded in the nucleus. Organelles do not have flagella. Mitochondrial rRNA genes are most similar to the rRNA gene of a bacterium. Organelle translation is inhibited by antibiotics that inhibit prokaryotic translation...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
In 1994, Congress passed the DNA Identification Act which authorized the FBI to do 2 things: (1) create and maintain a national DNA database, and (2) establish standards for forensic DNA testing. Because the human genome is full of DNA tandem repeats and because they vary in the number of contiguous repeat units, it was decided to use tandem repeats to build the DNA database. In 1996, 13 loci were chosen to be the core short tandem repeats (STR) for...
Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
You decide to make a construct that places the DNA between the
genes upstream to a reporter gene (GFP) in place of Gene 1. The
full-length construct has the correct expression pattern in
antennal discs. You then create several constructs that delete
sections of the upstream DNA and score them for expression. The
seven constructs are shown below; the black bars indicate the
region(s) deleted in each construct. The data table on the right
shows the expression results for each...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago