Question

Translate the following DNA sequence: DNA template: 3' G C T A C C G G...

Translate the following DNA sequence:

DNA template: 3' G C T A C C G G A G T A A T A C T 5'

What are the tRNA anticodons for the sequence?
DNA template: 3' G C T A C C G G A G T A A T A C T 5'

anticodon 1: 3'

5'

anticodon 2: 3'

5'

anticodon 3: . 3'

5'

anticodon 4: 3'

5'

anticodon 5: 3

0 0
Add a comment Improve this question Transcribed image text
Answer #1

First Part:

Given DNA template, 3' G C T A C C G G A G T A A T A C T 5'

Now, transcription always occur in 5' to 3' direction.

So, after transcription mRNA sequence will be-

5' C G A U G G C C U C A U U A U G A 3'

Now, translation also occurs in 5' to 3' direction & first mRNA that will be translate is AUG. So, after ignoring first two nucleotides (C & G) translation will begin. AUG will code for methionine, GCC will code for alanine, UCA will code for serine, UUA will code for leucine. UGA is stop codon & after encountering it, translation will stop. So, amino acid sequence after translation will be Met-Ala-Ser-Leu.

Second Part:

anticodon 1 (For AUG): 3' UAC 5'

anticodon 2 (For GCC): 3' CGG 5'

anticodon 3 (For UCA): 3' AGU 5'

anticodon 4 (For UUA): 3' AAU 5'

anticodon 5 (For UGA): 3' ACU 5'

Add a comment
Know the answer?
Add Answer to:
Translate the following DNA sequence: DNA template: 3' G C T A C C G G...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate...

    2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • 3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ -...

    3. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’ - T A C T G A C T G A C G A T C - 5’. Each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. a. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence. b. Transcribe (indicating 5’ and 3’ ends) the...

  • 1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2....

    1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2. As a result of mutation, DNA sequence 5' A-G-A-T-G-A-C-T-G-A-A-G-T-C 3' changed into 5' A-G-A-T-G-A-C-T-G-A-G-T-C 3'. Which type of mutation is this? 3. What is the result of the following reaction" Fructose-6-phosphate + ATP (phosphofructokinase) -------> ? 4. Which steps of glycolysis are irreversible and used for its regulation (just step numbers are okay)? 5. What are the products of one turn of the citric...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • Question 3 (4 pts): The following table provides just enough information about a section of a...

    Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • 11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT |...

    11.36 The following portion of DNA is in the template DNA strand: 3' GCT] TIT | CAA | AAAS , a. Write the corresponding mRNA section. Show the nucleic acid sequence as triplets and label the 5' and the 3' ends. b. Write the anticodons corresponding to the codons on the mRNA c. Write the three-letter and one-letter amino-acid sequence that will be placed in a peptide chain.

  • You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

    You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT