Question

The Sanger method of DNA sequencing requires what type of dNTP modification to generate truncated DNA...

The Sanger method of DNA sequencing requires what type of dNTP modification to generate truncated DNA products? How are individual dNTPs identified? How are the different sizes of DNA separated from each other?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Sanger sequencing is a method of DNA sequencing. This method is generally used to sequence up-to 800 base pairs. Sanger sequencing applies the principle of chain termination where modified deoxynucleotide triphosphates (dNTPs) are used which are called 2’,3’-dideoxynucleotides triphosphates (ddNTPs). A nucleotide triphosphate is made up of deoxyribose sugar, nitrogenous base attached at the 1’ position of the sugar and a phosphate group at the 5’ position. When the nucleotide attaches to a growing chain of nucleotides forming a DNA strand, the phosphate group of the nucleotide attaches to the 3’ position of the previous nucleotide’s deoxyribose sugar. This is because of the hydroxyl group (-OH) present at the 3’ position in the sugar to which the phosphate group attaches via phosphodiester bond. But in case of a ddNTP, the 3’ position lacks the -OH group. So the incoming nucleotide cannot form the phosphodiester bond and the chain terminates at the dideoxynucleotide. Due to this, when dideoxy nucleotides are included in the reaction, DNA strands of varying lengths are recovered. Sanger sequencing is therefore also called chain terminating or dideoxynucleotide sequencing.

An essential required for DNA sequencing is single stranded DNA (ssDNA) (template DNA) which is obtained by polymerase chain reaction (PCR). The ssDNA obtained is mixed with the following components to prepare an aliquot: oligonucleotide primer, DNA polymerase enzyme, the deoxynucleotide triphosphate (either of dATP, dCTP, dGTP, and dTTP in each aliquot). Each aliquot with the specific dNTP is added with its respective ddNTPs (ddATP, ddCTP, ddGTP, or ddTTP) which is radioactively labelled with isotope 32P. Apart from radioactive labelling, fluorescent labelling of the ddNTPs is also favoured where each of the four ddNTPs are labelled with different fluorescent dyes.

At the 3’ end of the DNA strand, the primer attaches and begins the complementary strand synthesis. Since the ddNTPs terminate the chain formation after incorporation in the growing DNA strand, various DNA strands with different lengths but same 3’ end will be obtained for each ddNTP.

To identify the dNTPs in the DNA chain before it terminated by the addition of ddNTPs, the aliquot for each dNTP is loaded in individual wells in a thin, long polyacrylamide gel. Since the ddNTPs are radioactively labelled, they can be analysed through autoradiography. Each ddNTP in the gel will appear as a dark band and the position of each band in a lane specifies the position of the nucleotide in the DNA strand. In fluorescent labelling, the color of the nucleotide bands is considered while sequencing. The bands are read from bottom to top of the gel. The sequence obtained is in 5’-3’ direction. This is the sequence of the strand synthesized from the original template DNA. The complementary sequence of the synthesized DNA strand will be the template DNA sequence.

Add a comment
Know the answer?
Add Answer to:
The Sanger method of DNA sequencing requires what type of dNTP modification to generate truncated DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • O The Sanger method of DNA sequencing requires which of the following to be in the...

    O The Sanger method of DNA sequencing requires which of the following to be in the reaction tube? Choose one: O A. template DNA O B. deoxyribonucleotides O C. dideoxyribonucleotides O D. A, B, and C are correct. O E. Only A and B are correct. O F. Only A and Care correct. O O O

  • Sanger sequencing allows the identification of the bases and their order in a target piece of...

    Sanger sequencing allows the identification of the bases and their order in a target piece of DNA. This technique exploits the way DNA is transcribed by using a primer and allowing new DNA to be created from its 3' end. In this technique, DNA is manufactured in vitro, which means that enzymes and molecules are combined in a test tube to allow the reactions to occur. In the original technique, four tubes were prepared, each containing the same reactants, but...

  • ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger...

    ddATP ddCTP ddGTP ddTTP The autoradiogram shown was obtained from a DNA sequencing method called Sanger sequencing or dideoxy sequencing. The arrow shows the direction of migration of the DNA samples during electrophoresis. Determine the sequence of the DNA template strand, in the 5' to 3' direction, from this data. 5' – CGTCAATTTAG

  • DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make...

    DNA Sequencing Techniques Compare/contrast Sanger sequencing, pact-bio, and oxford nanopore sequencing techniques. Include how to make a library, and why you would use each one in respect to cost, size, % error, etc. Consider budget, what you want to get out of it, and is there merit to combine different technologies together?

  • What would the results of a Sanger sequencing read look like if you accidentally omitted the...

    What would the results of a Sanger sequencing read look like if you accidentally omitted the deoxyCTP (dCTP) from the reaction? Multiple Choice No Cs could be incorporated into synthesis products, and so only peaks corresponding to the smallest synthesis products - none of which include a C - will appear. The results would be normal; dCTP is not required for Sanger sequencing - the only kind of C needed is ddCTP. All of the synthesis products would end with...

  • A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling...

    A scientist is doing a classical Sanger sequencing reaction. He sets up four reaction tubes, labeling them G, A, T, and C. To each tube he adds template, DNA polymerase, buffer, primer, all four dNTPs, and accidently, small amounts of all four ddNTPs. He then runs his samples on a sequencing gel. What do you think the gel will look like? The G, A, T, and C lanes will all look like normal, and it will still be easy to...

  • 3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...

    3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...

  • The observation that in any DNA sample, A T and G C A. DNase sequencing An...

    The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...

  • Explain what type of method you would use to identify screen for the DNA variant for...

    Explain what type of method you would use to identify screen for the DNA variant for each of the following scenarios; a) A well-characterized missense mutation associated with an inherited recessive disorder. Afamily member has the disease and the siblings are tested to see if they are carriers. b) An individual is born with an intellectual disability along with a heart valve disorder that could be linked to 7 different genes. c) An individual has a disorder that is not...

  • In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the...

    In DNA sequencing, ddNTPs differ from dNTPs in that ddNTPs are lacking a OH at the a. 2' carbon b. 5' carbon c. 3' carbon please answer as many as you can!! I am low on questions and could use the help! Mother || Child II Male 1 Male 2 Results from a paternity test using DNA fingerprinting is shown. DNA was isolated from a mother, her child and 2 potential fathers. Primers designed to amplify different satellite DNA regions...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT