the following is region of an eukaryotic mRNA:
5’-ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCA
UUAUCCUAUUAAAGGGAACUGAGGUGA-3’
A. Somewhere near the 5’ end is the Kozak consensus sequence. Using the given genetic code table, what would be the first 7 amino acid residues of this protein? Indicate polarity.
B. How would the protein change due to the following mutation on the mRNA (be very specific and completewith your answers):
The deletion of nucleotide at position 22 (italicized)?
The G nucleotide at position 27 (italicized) is changed from a C?
The deletion of the nucleotide at position 31 (italicized)
Answer-
According to the given question-
Here we have a region of a eukaryotic mRNA-
5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
We know that DNA ---> RNA ----> Protein is called central dogma, Where the information present in DNA is transferred to mRNA in the form of codons, which later translated into Amino acid sequence by the process of translation.
mRNA sequence -
5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
A - Amino acid sequence - N -terminal- Met - Ala - Met - Ser - Thr - Pro - Val - Ser - Ala - Leu - Ser - Tyr - C- terminal
first 7 amino acid residues of this protein will be- N -terminal- Met - Ala - Met - Ser - Thr - Pro - Val - C terminal
B.
(i) deletion of nucleotide at position 22 -
Normal mRNA sequence - 5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
Mutated mRNA sequence-
5’ACGCGCCUUCACACAGGAACACUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
Amino acid sequence - N -terminal- Met - Ala - Met - Ser - Thr - Pro - Val - Ser - Ala - Leu - Ser - Tyr - C- terminal
Change in a nucleotide at the 22 positions, is a type of point mutation, generally a deletion mutation, this does not cause any change in length of the Amino acid sequence and the length of the amino acid chain is the same as the original and native amino acid chain.
(ii) The G nucleotide at position 27 is changed from a C-
Normal mRNA sequence - 5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
Mutated mRNA sequence-
5’ACGCGCCUUCACACAGGAACAGCUAUCGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
Amino acid sequence - N -terminal- Met - Ser - Thr - Pro - Val - Ser - Ala - Leu - Ser - Tyr - C- terminal
Change in a nucleotide at the 27 positions i.e. G is replaced by C, this is a type of point mutation, generally, a transversion, where the purine is replaced by pyrimidine nitrogenous base and vice-versa, this causes the change in length of the Amino acid sequence and the amino acid chain was have two amino acids less than the original and native amino acid chain. this causes the dysfunctional or less functional protein formation due to change in nucleotide.
(iii) The deletion of the nucleotide at position 31-
Normal mRNA sequence - 5’ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
Mutated mRNA sequence-
5’ACGCGCCUUCACACAGGAACAGCUAUGGCCUGAGCACGCCAGUCUCGGCAUUAUCCUAUUAAAGGGAACUGAGGUGA-3’
Amino acid sequence - N -terminal- Met - Ala - C- terminal
Change in a nucleotide at the 31 positions, is a type of point mutation, generally a deletion mutation, this causes the change in length of the Amino acid sequence and the amino acid chain was have only two amino acid long than the original and native amino acid chain. this causes the dysfunctional or less functional protein formation due to change in nucleotide.
the following is region of an eukaryotic mRNA: 5’-ACGCGCCUUCACACAGGAACAGCUAUGGCCAUGAGCACGCCAGUCUCGGCA UUAUCCUAUUAAAGGGAACUGAGGUGA-3’ A. Somewhere near the 5’ end is...
Below is a partial mRNA sequence. Use it to answer the following questions. 5 - UGGUCGGCGAGAACGAAAGCGC - 3 The amino acids in the original partial sequence (N-term-...V-G-E-N-E-S...-C-term) have little to no impact on protein structure and function, with the exception of serine. Phosphorylation of the serine residue is required for normal function of the protein. Given this information, which reversion mutation(s) in the gene would restore the normal function of the entire protein? Select the four correct answers. Deletion of...
a piece of eukaryotic DNA is shown below: 5’- CACTCACCCGATTTTTGAATGCCGCTGATGAATCTCTGGTAA -3’ A) WHAT IS THE mRNA PRODCUED, IF THIS IS THE CODING STRAND? b)Assuming that after processing, a cap is added to the mRNA at the 5’ end, predict the amino-acid sequence of the protein produced from this piece of mRNA using SINGLE LETTER codes. In your answer denote both the amino and carboxy ends of the protein? THANKS FOR THE HELP.
4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...
5 pts Question 23 Life on Earth uses 3 nucleotide long code words, with 4 letters in the alphabet to encode 20 amino acids. DNA on the planet Arth only contains A, G and C. In addition, proteins on Arth are made from 26 different amino acids. What is the minimum number of nucleotides in a codon needed to code for life on Arth? Hint: In humans a 3-letter code can represent 4 x 4 x4 = 64 amino acids...
7. (6 points) One strand of a section of DNA reads 3-TAGTATGCTAgaatATTTGA-3' Suppose that an mRNA is transcribed from the complementary strand (not shown) to this DNA. What will be the sequence of the pre-mRNA (make sure you label the 5' and 3'ends)? BUCO BUCO DUCO DUCO B. The lowercase letters in the sequence above represent an intron. Starting at the ATG, what would be the protein sequence once the intron is properly removed? с Two mutations occurred. 1) A...
Genetic Code: The dictionary of the language of life Use the Genetic Code as a "dictionary" to solve the exercises on next page 5. If a mutation happens in the DNA that changes the T at base 14 to a G: a) What would be mutated sequence of nucleotides in the corresponding codon in the mRNA and the anticodon in the tRNA? Is there any change in the corresponding amino acid in the protein? b) What is the name of this type of...
Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...
Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’