You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator...
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5’-----------3’ of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or T nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel.
A C G T L
Homework Answers
Add Answer to:
You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3)
with a reverse primer (5-CGCTTAACC-3) with radioactive labeled
chain terminator...
pls help ? Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3)...
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A,...
1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template...
Can you help me design a forward primer using this sequence? 5´ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC 3´ and a reverse...
Can you help me design a forward primer using this sequence? 5´ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC 3´ and a reverse primer with this sequence ´5-CGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAA-3´
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into...
Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into a plasmid, transform it into bacterial cells and isolate DNA from one of the bacterial colonies. You use the Sanger sequencing method to determine the sequence, separating the products from the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.
The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
If you wish to sequence a long strand of DNA in one round of reactions, you...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
please help me with both of these questions!!!! 3:33 PM Wed Mar 18 Enter answer... 5:06...
please help me with both of these questions!!!!
3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
pls help ?
Font Q10B. You would sequence a gene (5-CCGATTAAGGCTTAACTAACCGGTTAAGCG-3) with a reverse primer (5-CGCTTAACC-3) with radioactive labeled chain terminator nucleotides. Fragments were run on a polyacrylamide gel to read a sequence from 5 3' of the gene sequence. Fill each lane on the gel with bands which terminate with either A, C, G, or I nucleotide. Also, mark the size of the fragments in lane L. Write the complete sequences as you read off the gel. (5 points)...
The following diagram represents a replication bubble associated
with DNA synthesis. Based on this diagram, select all of the
options below that are true.
1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...
3.13 pts) The restriction enzyme known as Notl recognizes the following sequence: 5-GCGGCCGC-3 3-CGCCGGCG-5 However, if the cytosines in this sequence have been methylated. NotI will not cleave the DNA at this site. For this reason, Net is commonly used to investigate the methylation state of CpG islands. A researcher has studied a gene, which we will call T. that is found in com, and encodes a transporter involved in the uptake of phosphate from the soil. A CpG island...
Luestion 3 1 pts Review: You have the DNA that is radioactively labeled at the S'ends of DNA as shown below. But you want DNA that is labeled only at one end of the DNA, not both ends. One of the other undergraduate students in the lab suggests that you use a restriction enzyme to cut the DNA, then electrophorese the DNA in an agarose gel, then cut out the region of the gel with radioactive DNA fragment you want,...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
If you wish to sequence a long strand of DNA in one round of reactions, you should: O A. Decrease the ddNTP/dNTP ratio O B. Increase the ddNTP/dNTP ratio O C. Use a shorter DNA primer O D. Add twice as much primer Based on this figure, the most likely error is: O A. The scientist forgot to add dNTPs to one of the reaction tubes. O O B. <label for="q7_4" id="lq7_4">The scientist did not denature the DNA strands</label> O...
please help me with both of these questions!!!!
3:33 PM Wed Mar 18 Enter answer... 5:06 Exit You are trying to amplify an eye color gene in Drosophila. Based on the DNA sequence for the gene, you design the following primers: Forward Primer: 5' GCATGCTGAG CCTAGTAACT 3 Reverse Primer: 5' CTTAAAGCTT ACTGGTCAAC 3' True or false? These are good primers to use in PCR. Hint: use the formula: Tm (in C) = 4(G+C) + 2(A + T) True False ormula:...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago