Question

At the end of gel electrophoresis, what would you expect to find? the largest fragments closest to the wells O the mid-sized
0 1
Add a comment Improve this question Transcribed image text
Answer #1

The gel elctrophoresis is the process of separation of DNA fragments on the basis of the size. DNA is a negatively charged particle, so in this process when the electric current is applied the DNA will travel from negative to the positive side. Since the charge is similar on all fragemnets so the DNA will moves according to the size. The smaller DNA molecule will move faster and will be near the positive side while the larger molecule will move slow and will present near the negative pole or the well in which it was loaded.

The answer is D.

Add a comment
Know the answer?
Add Answer to:
At the end of gel electrophoresis, what would you expect to find? the largest fragments closest...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If you stopped gel electrophoresis halfway during the running time, what would you expect? not all...

    If you stopped gel electrophoresis halfway during the running time, what would you expect? not all the fragments have separated from each other in the gel yet the smallest fragments will still be in the loading well of the gel the largest fragments will be at the opposite end of the gel

  • What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly,...

    What would happen to DNA if the gel tray within an electrophoresis chamber were placed incorrectly, with the wells closest to the positive electrode? Choose one: A. DNA would remain in the gel. B. DNA bands would appear smeared. C. DNA would be pulled through the gel in the wrong direction. D. DNA would not fluoresce under UV light.

  • • What would you expect to see on a gel if PCR is performed for a...

    • What would you expect to see on a gel if PCR is performed for a microsatellite in a person with a genotype indicated by: • (Allele 1: 3 TAGA repeats) • (Allele 2: 6 TAGA repeats) -----------TAGATAGATAGA----------- -----------TAGATAGATAGA TAGATAGATAGA--- A. 9 bands on the gel (or capillary electrophoresis) B. 6 bands on the gel (or capillary electrophoresis) C. 3 bands on the gel (or capillary electrophoresis) D. 2 bands on the gel (or capillary electrophoresis) E. 1 band on...

  • What would you expect to see on a gel if PCR is performed for a microsatellite...

    What would you expect to see on a gel if PCR is performed for a microsatellite in a person with a genotype indicated by: (Allele 1: 3 TAGA repeats) (Allele 2: 6 TAGA repeats) ---TAGATAGATAGA------ ---TAGATAGATAGA TAGATAGATAGA-- A. 9 bands on the gel (or capillary electrophoresis) B. 6 bands on the gel (or capillary electrophoresis) C. 3 bands on the gel (or capillary electrophoresis) D. 2 bands on the gel (or capillary electrophoresis) E. 1 band on the gel (or...

  • 6a. What is the size of the uncut pKAN? __________________ What would this look like if...

    6a. What is the size of the uncut pKAN? __________________ What would this look like if you ran it on a gel? Explain. 6b. If you cut pKAN with one enzyme, how many fragments would you see if you ran the sample on gel electrophoresis. What size would the fragment(s) be? 6c. If you performed a double digest of pKAN with BamHI and HindIII, how many fragments would you see if you ran the sample on gel electrophoresis? What size...

  • Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for...

    Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for studying human ancestry? 11. Why do the two possible PCR products from our lab differ in size by 300 base pairs? 12. Explain how gel electrophoresis separates DNA fragments 13. Fill in the table below. For each genotype, write how many DNA bands (fragments) you would expect to see in a gel, along with the size of each (n base pairs) Table 1. Predicted...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • The picture above represents an agarose gel that was used to analyze plasmid DNA after it...

    The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...

  • can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...

    can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...

  • 1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see...

    1. If a restriction enzyme cuts a circular plasmid twice, how many fragments would you see on the gel? 2. How would you estimate the total number of base pairs in a plasmid by looking at the DNA fragments of the digested plasmid on a gel? 3. If a linear 1kb DNA fragment has a restriction site that is located 50 bp from one end of the plasmid, what would you expect to see if the digested and undigested DNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT