Answer:
As the sequence of DNA has been provided in a picture format, it is not possible to copy the sequence in database for its identification and further analysis.
Therefore, I can recommend you few steps which can be followed to obtain the answers of your question.
1, To identify the sequence, go to the NCBI Blast (there is blatn for neucleotide blast and blastp for protein blast).
Note: BLAST: Basic Local Alignment Search Tool.
You need to go to neucleotide Blast of NCBI and paste your DNA sequence in the query box. Now you can click on blast with ticking the option of highly smilar sequence. In the next page you will get several matches to your query with different values for identity percentage. Now choose the option with highest or 100% identity value.
You may capture this screen for evidence as well.
2. Translation is the process of protein synthesis from mRNA.ORF is known as Open Reading Frame (ORF is the neucleotide sequence that is translated to a protein and it begins with ATG as start codon and ends with a stop codon: either UGG, UGA or UAA).
From the given nucleotide sequence, you can easily find the correct ORF using online bioinformatic tools.
First you copy the whole sequence and go to Expasy translate tool page in your browser.
In this tool, paste your sequence and click on translate tab to obtain various reading frames with your neucleotides getting translated into amino acids from N to C terminal.
Every sequence can be translated into three reading frames as every amino acid is coded by three consecutive neucleotides (a single codon). So, in every sequence, the firt reading frame begins with first neucleotide, second with second neucleotide and third with third neucleotide, but fourth neucleotide would form the part of codon which would be included in first frame.
Hence, in this regard, chose the best fit reading frame as ORF, the begining amino acid should be Methionine (Met/M).
3. For obaining the restriction map of your given sequence, paste the neucletides in the box of "NEBcutter" and click on Submit to get the restriction sites as well as the restriction map. A table of Restriction enzyme cutters and the sites for cutting will be provided which can be referred for tracing the hexacutter sites.
Thank you.
If any problem arises while solving, let me know by commenting below.
Give a thumbs up if you are able to understand this.
Analyze the following sequence of DNA by answering the related questions: aggttaggat ttgccactga ggttcttctt tcatatactt ccttttaaaa...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
QUESTION 31 You have a DNA sequence of 1600 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1200 bp, respectively. After using the second enzyme, you recover 700-bp and 900-bp fragments. After treatment with both enzymes, fragments were 300, 400, and 900 bp. Which is the correct map? O -400/--900----/300 --- -300-/--400--/--900---- O-900 ------/400--/3-- -400-/300----900--- -400-/-100/--300--/900 QUESTION 32 Which of the...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...
6. Using the answers to questions 2-5 and the below DNA sequence, predict the mRNA sequence, the tRNA anticodons, and the amino acid sequences (use the three letter code) that would result from it. (3 points) DNA +1 15'GICIA I G C A A CICATI I AA GG 3' 3" CA GATA C GTIGA GIA A A IICC 5 mRNA tRNA anticodons amino acids 7. You are interested in a gene that codes for a 20 amino acid-long protein. (1.5...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Please I need help on questions 1-4 in great detail please
Load 15 mu l of the following samples from the above section onto the simple Wells. Seal the wells with agarose and electrophorese until the bromophenol blue in the samples has migrated to within 2 mm of the positive electrode end of the gel. Remove the gels from the unit and stain them as described in Section IV. Measure the distance of the DNA bands (in cm) from the...
A. Your lab To see if you understand what you did in our lab, answer the following based in the procedures for the restriction digest and the gel electrophoresis. 1. Using the PGLO map on p7 of the gel electrophoresis procedure, predict the size of the fragments generated by each enzyme EcoRI Hindill, and Pst! (the sizes you would expect to see on the gel.) (6 pts) Hindill -8 fragments were produced by the restriction enzyme. 2. Answer the calculation...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
Can somebody help me with question 2 and 3?????
Analyse the 300 bp DNA sequence given below to find certain important sequence details on it from a gene function point of view, and certain restriction sites on it, for its physical mapping cloning purposes You may need to use the genetic code (from lecture notes). Address the following activities questions AGCATATCGG CCAATCTCAA ATTTGGGCCC CAAT (Start) ATCATCGTAT TGTTTTTCCTAATGGCCGAAGG HisTyrArg GCCGGCAGCG GATCCGCGCG CTATATACAT CvSTrp SerPhe Glv euProAla TTTTACCCGC le G?VÀrg(Sto AGGCCGIT ATGTCCGAAA...