Question

The strategy for obtaining a genomic sequence can be divided into four steps: 1) overlap contigs...

The strategy for obtaining a genomic sequence can be divided into four steps:

1) overlap contigs for complete sequence,

2) sequence each fragment,

3) cut many genome copies in to random fragments,

4) overlap sequence reads.

What is the order of the four steps?

A) 1, 2, 3, and 4

B) 2, 4, 3, and 1

C) 3, 2, 1, and 4

D) 3, 2, 4, and 1

E) 4, 3, 2, and 1

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The strategy for obtaining a genomic sequence can be divided into four steps as follows in an order. 3) Cut many genome copie

Add a comment
Know the answer?
Add Answer to:
The strategy for obtaining a genomic sequence can be divided into four steps: 1) overlap contigs...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction)....

    Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction). Assemble them into one continuous sequence. What is the order of the fragments? Fragment #1: CCGGTATGTGTGTGTG Fragment #2: CGTACGTGGGGGAAA Fragment #3: ATGCGATCGTACG Fragment #4: ATACCGGTTTCCCCC A. 1-2-3-4 B. 1-3-2-4 C. 1-4-3-2 D. 2-1-4-3 E. 2-3-1-4 F. 2-4-3-1 G. 3-1-4-2 H. 3-2-4-1 I. 3-4-2-1 J. 4-1-2-3 K. 4-2-1-3 L. 4-3-1-2

  • The following is a small part of a vector DNA sequence showing the NdeI and SacII...

    The following is a small part of a vector DNA sequence showing the NdeI and SacII cut sites.  The bases recognizedby the enzymes are in bold. They both are Class II restriction enzymes. These enzymes recognize a specific sequence of palindromic bases, i.e., reads the same on both strands    1. When you cut this DNA, shown in the figure above, by NdeI, it will generate sticky ends. Write the two pieces of DNA that will result after NdeI digestion and...

  • And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues?...

    And.. Exercise1: Give the basic steps involved in extracting genomic DNA from animal cells and tossues? 23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...

  • A research associate working for Intragene Therapeutics prepares an investigative PCR reaction to screen human tissue...

    A research associate working for Intragene Therapeutics prepares an investigative PCR reaction to screen human tissue samples for specific mutations. He uses 55 ng of genomic DNA from one tissue sample in a single PCR reaction, to amplify a 1,246 bp fragment. The PCR protocol requires a final concentration for two primers of 1.5 uM each, and a final concentration of 180 uM for dNTPs, in a total PCR reaction volume of 65 uL. During the PCR process, the fragment...

  • Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...

    Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then you ligate the resulting fragment into a unique BamHI cloning site of a plasmid. The sequence of the restriction sites and position of cleavage is shown below Note: X and Y and their complementary bases Z and Y’ respectively can be any base (A,C, G, or T) 1) As you can see, ligation is possible because the two restriction enzymes produce compatible sticky ends....

  • 10. A lab process consists of four steps that can be performed in any sequence. The...

    10. A lab process consists of four steps that can be performed in any sequence. The complexity of each task differs. The lab director decides to conduct a study to determine the order of performing the tasks that will result in the lowest number of errors. If he wants to consider all possible orderings of the tasks, how many sequences will be studied?

  • A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1)...

    A DNA sequence has been cut into the three overlapping sequence fragments (in 5'-to-3' orientation) (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments? a. GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT b. CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG OC CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT d. AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA Oe. AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC X represents the ratio of the number of protein-coding genes in the typical eukaryote genome to the number of protein-coding genes in the typical prokaryote genome. Y represents the ratio of total genome size in the typical eukaryote to the...

  • Write true or false ______ 1. The DNA sequence of one human being is on average...

    Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...

  • command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a)...

    command 145 Genetics Assignment Genomic Analysis 1. Some bacteria normally produce endonucleases for what purpose? a) necessary digestion of their own genome b) defense against viral infection c) bacteria never make endonucleases naturally 2. A blunt cutter produces DNA fragments with complementary overhanging regions. a) True b) False 3. Which of the following DNA sequences (when double-stranded) most likely represents a restriction endonuclease site for a 6-mer cutter? a) AGTAAGCTTC c) AGAGAGCCAA b) GGTAGATTCC d) None of the above 4....

  • Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequ...

    Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequence is detected, the detector output a 1'. Please consider 'overlap', which means that even if the sequence '0110 is detected, the detector still can reuse the history data. Design a Mealy FSM. 1) .(5 points) Draw the state transition diagram. 2) (2 points) How many states are there? How many bits are needed to encode the states? 3) -(4 points) Write down the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT