Homework Answers
Add Answer to:
Given the following diagram of a typical eukaryotic coding gene, draw a basic sketch showing gene...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
answer parts e, f, and g 4. Look at the following diagram of a eukaryotic gene...
answer parts e, f, and g
4. Look at the following diagram of a eukaryotic gene Polyadenylation anal region (100bpl ADNA 11,000 pl (1000bp) Con 1450b) chel 1750 a) At which section would transcription initiation occur? List the letter of the section. (0.5pts) b) Identify all sections that would be present in the pre-mRNA transcribed from this gene. List the letter of these sections. (0.5pts) c) Name the three processes that must occur to create a mature processed mRNA in...
The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold...
The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the...
1. A sequence of a eukaryotic gene (coding strand) is shown below, RNA polymerase recognizes the sequence ‘TATAAT’ and initiates transcription six nucleotides downstream of the sequence. The in tron splice sites are CUU (5’ splice site) and AAG (3’ splice site), poly -A tails are added following the sequence AGUUGG. The poly- A tails are 20 nucleotides. a. Predict the sequence of mature mRNA and denote 5’ and 3’ ends. b. If this is an oncogene that is elevated...
Please solve each item in a detailed and descriptive way. Q5. Total 35 pts. Below given...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
Could you please provide me the answer for following multiple choice question- subject- Genes, Genomics and...
Could you please provide me the answer for following multiple choice question- subject- Genes, Genomics and Human Health( Genetics) Question-2 Question 2.1 Whole genome DNA sequencing can be applied to genome-wide association studies to sequence the genomes of as many as 100,000 individuals search for rare Mendelian coding mutations search for very rare variants on haplotypes identified in genome-wide genotyping studies identify family pedigrees in large populations Question 2.2 Next Generation sequencing aims to sequence the genome to a coverage...
MUN for the rapid SA can be enormously benehciarlo NS FOR FURTHER REVIEW be found in...
MUN for the rapid SA can be enormously benehciarlo NS FOR FURTHER REVIEW be found in the answer section at the back wers only after you have attempted to solve th at the back of this d to solve the ques- Answers to these questions can be found in the study guide. Refer to the answers only after you tions ON JONr Own. Multiple Choice 1. DNA genomes are found in: a. All organisms and all viruses b. All organisms,...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving...
2. A dominant allele H reduces the number of body bristles that Drosophila flies have, giving rise to a “hairless” phenotype. In the homozygous condition, H is lethal. An independently assorting dominant allele S has no effect on bristle number except in the presence of H, in which case a single dose of S suppresses the hairless phenotype, thus restoring the "hairy" phenotype. However, S also is lethal in the homozygous (S/S) condition. What ratio of hairy to hairless flies...
Please read the article bellow and discuss the shift in the company's approach to genetic analysis....
Please read the article bellow and discuss the shift in the
company's approach to genetic analysis. Please also discuss what
you think about personal genomic companies' approaches to research.
Feel free to compare 23andMe's polices on research with another
company's. Did you think the FDA was right in prohibiting 23andMe
from providing health information?
These are some sample talking points to get you thinking about
the ethics of genetic research in the context of Big Data. You
don't have to...
The diagram below shows a structure of an eukaryotic gene. Each pattern refers to a different part of a gene. Using the pattern, label the diagram for the location of following: a. enhancer, b- promoter, c- transcription start, d- translation start: e- exon, i- intron, f- coading sequence, t1 -transcription stop, t2 -translation stop Put the corresponding letter on top of the pattern to show the location b. How pre-mRNA transcribed from this gene will look like? You may use...
answer parts e, f, and g
4. Look at the following diagram of a eukaryotic gene Polyadenylation anal region (100bpl ADNA 11,000 pl (1000bp) Con 1450b) chel 1750 a) At which section would transcription initiation occur? List the letter of the section. (0.5pts) b) Identify all sections that would be present in the pre-mRNA transcribed from this gene. List the letter of these sections. (0.5pts) c) Name the three processes that must occur to create a mature processed mRNA in...
Please solve each item in a detailed and descriptive way.
Q5. Total 35 pts. Below given single stranded DNA sequence was retrieved from a prokaryote; Promoter region is shown with yellow color Transcription start site is shown with green color Ribosome binding site is shown with blue color 5'ATAGTCGTCGATCGATGGCTTAGCTAGCTTCGATTTCGTAGCTCTGATTAAACGCGCGCATATATCGAT ATCTAGCTAGCTATATTCGCTGATCGCTAGTGTGCGTGATGCTGCTAGGATCAGGTATCGGTCTGATCTA GTATTAGTGCCCGTAGCTGATGCTTCGTCGTAGATCGCTGATTCGCTAATAGGCTGCTAGTCGATGCTGT A3' A) Write the sequnce of double stranded DNA from given single stranded DNA sequence. (5 pts) B) Show template DNA strand used in transcription. (5 pts) C) Write...
Below is a series of events involved in the mechanism of forming a retrotransposon. Place these steps in the correct order 1. the DNA copy is made double-stranded 2. DNA of the transposable element is transcribed 3. The DNA of the transposable element is integrated into a target DNA site 4. The RNA is reverse transcribed by reverse transcriptase, producing a complementary DNA 4,2,3,1 3,2,4,1 2,4,1,3 4,2,1,3 1,2,3,4 What is the function of the poly(A) tail on most mRNAs To...
MUN for the rapid SA can be enormously benehciarlo NS FOR FURTHER REVIEW be found in the answer section at the back wers only after you have attempted to solve th at the back of this d to solve the ques- Answers to these questions can be found in the study guide. Refer to the answers only after you tions ON JONr Own. Multiple Choice 1. DNA genomes are found in: a. All organisms and all viruses b. All organisms,...
Please read the article bellow and discuss the shift in the
company's approach to genetic analysis. Please also discuss what
you think about personal genomic companies' approaches to research.
Feel free to compare 23andMe's polices on research with another
company's. Did you think the FDA was right in prohibiting 23andMe
from providing health information?
These are some sample talking points to get you thinking about
the ethics of genetic research in the context of Big Data. You
don't have to...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago