Question

Using the ActiveModel for Brca2 (the protein encoded by the BRCA2 gene associated with breast cancer susceptibility), discuss

Please explain in details

0 0
Add a comment Improve this question Transcribed image text
Answer #1

BRCA2 gene is located on the chromosome 13,another DNA repair gene,in its mutated form,has a similarity higher incidence of inherited cancer of breast in one third cases and ovary in females and prostate in men.

In BRCA1 as well as BRCA2 ,both copies of the genes[homozygous state] must be inactivated for the development of breast cancer.

Most BRCA2 gene mutations lead to the production of an abnormally small, nonfunctional version of the BRCA2 protein from one copy of the gene in each cell. As a result, less of this protein is available to help repair damaged DNA or fix mutations that occur in other genes.

Add a comment
Know the answer?
Add Answer to:
Please explain in details Using the ActiveModel for Brca2 (the protein encoded by the BRCA2 gene...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • For the gene BRCA2, identify the normal function of the protein encoded by the gene and...

    For the gene BRCA2, identify the normal function of the protein encoded by the gene and how the mutations of the gene causes Breast cancer via the role of the defective protein in the gene. Diagrams are appreciated to demonstrate the following concepts; 1) Signal Transduction - Is it paracrine signalling? I actually don't understand how the kinases work. 2) Cell Division- It is the S phase right but like I don't know how to phrase it 3) Genetics -...

  • If it does code for a gene, what is the protein sequence encoded by this DNA...

    If it does code for a gene, what is the protein sequence encoded by this DNA sequence? Explain how you can tell. Are there any regulatory regions encoded by this DNA sequence? How can you tell?TTATGTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGTTATGTTACTGACAGAGGAAGACAAAAGGTTGTTTCCATAACTGACACAACAAATCAGAAGACAGAGTTACAAGCAATTCATCTAGCTTTGCAGGATTCGGGATCAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGGATCATTCAAGCACAACCAGATAAAAGTGAATCAGAGTTAGTTAGCCAAATAATAGAGCAGTTAATAAATAAGGAAAAGATCTACCTGGCATGGGTACCAGCACATAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTTAGTGCTGGAGTCAGGAAAGTATAGTTT

  • IN CONTEXT OF GENE EXPRESSION AND PROTEIN SYNTHESIS OUTCOME 5. a), Why are Proto-Oncogenes important for...

    IN CONTEXT OF GENE EXPRESSION AND PROTEIN SYNTHESIS OUTCOME 5. a), Why are Proto-Oncogenes important for the cell cycle control and what is their implication in a progression of tumors and cancers? Provide examples of TWO proto-oncogenes and a type of a cancer each is associated with. (6 pts) b) Now consider the diagram below. Under each of three scenarios, explain a likely cellular consequence relative to gene expression and protein synthesis outcome, assuming each could lead to a development...

  • The gene APC encodes a protein important for cell-cell adhesion and contact inhibition, the phenomenon in...

    The gene APC encodes a protein important for cell-cell adhesion and contact inhibition, the phenomenon in which cells know when to stop dividing based on interaction with neighboring cells. A mutation in APC is associated with colon cancer. How is this gene classified? a. tumor-suppressor b. passenger mutation c. gene mutation d. proto-oncogene

  • Please answer 2-5 2. Consider a gene with a particular function. Mutation X and mutation Y...

    Please answer 2-5 2. Consider a gene with a particular function. Mutation X and mutation Y cach cause defects in the function of the encoded protein, yet a gene containing both mutations X and Y encodes a protein that works even better than the original protein. The odds are exceedingly small that a single mutational event will generate both mutations X and Y. Explain a simple way that an organism with a mutant gene containing both mutations X and Y...

  • An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant...

    An enzyme, encoded by gene A, converts substrate X into product Y. Individuals with a dominant mutation in gene A over accumulate substrate X, which causes severe neurological symptoms. At the molecular level, this enzyme functions as a homodimer. A homodimer is a protein composed of two subunits that are encoded by the same gene. Let’s suppose you are able to purify subunits from cell samples and then mix them together under conditions in which they form homodimers, and you...

  • For Biology of Cancer- Please Explain The regulation of expression of the Ah locus, the protein...

    For Biology of Cancer- Please Explain The regulation of expression of the Ah locus, the protein products regulated by the activities of each gene, the mechanisms of AH-induced gene expression. Should be able to reason (and give an example) on how a selective or aberrant regulation of the Ah-locus might affect the predisposition to malignancies associated with exposure to AH (such as in smoking).

  • A geneticist discovers that two different proteins are encoded by the same gene. One protein has...

    A geneticist discovers that two different proteins are encoded by the same gene. One protein has 56 amino acids, and the other has 82 amino acids. Which of the statements are possible explanations for how the same gene can encode both of these proteins? 1-The same gene encodes both proteins by using different combinations of introns in the pre‑mRNA via alternative splicing. 2-The same gene encodes both proteins by generating a poly(A) tail on the pre‑mRNA. 3-The same gene encodes...

  • please answer all 6 questions Question 27 3 pts TRBP is a protein important for the...

    please answer all 6 questions Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...

  • I need a reply to the discussion below! Debate forum 3: Debate question, is bilateral mastectomy...

    I need a reply to the discussion below! Debate forum 3: Debate question, is bilateral mastectomy a good preventative choice for women who have all the genetic markers for breast cancer? Yes is it a good choice for women who have all the genetic markers for breast cancer, but for women who don’t have all the genetic markers it is not necessarily a good choice. Breast cancer is the most common cause of cancer in women and second cause of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT