Question











d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence? Draw Conclusions: a. O
0 0
Add a comment Improve this question Transcribed image text
Answer #1

D. The anticodon is complementary to the original DNA sequence.

5 T - 3! coding strand IITINI 5) template strand dsDNA transcription 5 TITTITUUT mRNA (codon) 51 3 LIII!!!!!!!!!! ERNA (anti

Please rate high.

Add a comment
Know the answer?
Add Answer to:
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence?...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a....

    The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA codons and tRNA anticodons th b. c. Induce an insertion of one nucleotide in the original sequence? Do the same for 2 nucleotides then 3 d. Substitute one nucleotide in the original sequence. How does each insertion affect the amino acid at correspond with this sequence, and then give the sequence of amino acids in the polypeptide. induce a deletion in...

  • Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

    Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

  • DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your...

    DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...

  • Arrange the following molecules from least to most specific with respect to the original nucleotide sequence:...

    Arrange the following molecules from least to most specific with respect to the original nucleotide sequence: RNA, DNA, Amino Acid, Protein Identify two structural differences between DNA and RNA. Suppose you are performing an experiment in which you must use heat to denature a double helix and create two single stranded pieces. Based on what you know about nucleotide bonding, do you think the nucleotides will all denature at the same time? Use scientific reasoning to explain why.

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • You have found a strain of microorganism, Schizosaccharomyces spp that is very sensitive to mutagenic compounds....

    You have found a strain of microorganism, Schizosaccharomyces spp that is very sensitive to mutagenic compounds. When grown in the presence of known mutagens this organism produces many mutant progeny. This microbe, initially isolated from beer-stained carpeting from Zach’s apartment, is obviously deficient in repairing damage to DNA. You perform a series of experiments to determine which repair system is defective. A. You first take two identical cultures and expose them to 30 minutes of irradiation. You place one of...

  • QUESTION 13 Which of the following would occur if a mutation caused Kinase 1 to be...

    QUESTION 13 Which of the following would occur if a mutation caused Kinase 1 to be unable to be phosphorylated? (Select all) RTK would bind VEGF RTK would phosphorylate itself RAS would become active The phosphorylation cascade would occur The endothelial cell would divide 0.2 points    QUESTION 14 Imagine that an endothelial cell has a mutation in several of the enzymes that perform mismatch repair. The endothelial cell replicates its DNA and then divides into two cells. The resulting...

  • MATLAB Notes: B) Find likelihood for each sequence 1-9 for each hypothesis. First hypothesis with the...

    MATLAB Notes: B) Find likelihood for each sequence 1-9 for each hypothesis. First hypothesis with the fair coin (theta value = 0.5): what is the probability that we can get each sequence, 1 through 9. Second hypothesis with weighted coin(don’t know theta value): what is likelihood of getting sequence 1 through 9. Using equation to find all possible hundred theta values. For each theta value we need to compute likelihood. Then we sum them up across all possible theta values....

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT