Which two compounds require different amounts of O2 for a complete combustion? (a) ribose and galactose
Which two compounds require different amounts of O2 for a complete
combustion?
(a) ribose and galactose (c) fructose and mannose
(b) D-glucose and L-glucose (d) none of these pairs
Viruses don’t have ribosomes because:
(a) they already carry enough protein to make new virus particles.
(b) ribosomes are only needed for DNA synthesis.
(c) each infected cell builds new virus capsules from human protein.
. For the mRNA sequence 5’-AUU-CUA-CUA-3’, which mRNA sequence
represents a simple mutation that would lead to a change in the
protein produced from it?
(a) 5’-ACU-CUA-CUA-3’ (c) 5’-AUU-CUA-CUU-3’
(b) 5’-AUU-CUG-CUA-3’ (d) none of these
(d) None of these statements are reasonable explanations.
Homework Answers
Solution ::
Answer 1
Option b is correct
D-glucose and L-glucose
Answer 2
Option a is correct
they already carry enough protein to make new virus particles.
Add Answer to:
Which two compounds require different
amounts of O2 for a complete
combustion?
(a)
ribose and
galactose
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids...
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids in the peptide chain created. c A G UUU UẬC Phe UUA UAU Ty lucccys UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CUU CUC Leu CUA CCA Pro CUG CACCI CCG) ACU ACC ACA ACG sucu suco DUCU BUCO AUU AUC File AUA AUG Met GCU GCC GAC ASP GCA GUG GCG) GAG GUGGAGI GGG) Click Save and Submit to...
D) Consider that during replication of the cell. the following mutations were generated within the gene...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U C A UCA UUG/Leu บบบโphe UCU) UAUITVE UGUlays UCC Isor UAC JTyr UGC Cys Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp CUU CAULHis CGU) CUC CAC CGC CUA CCA Pro CAA CGA CUG) CCG CAGS CGG СС First letter DUCUDUCUDUCUDUCU Third letter AUU AUC lle AUA AUG Met ACU ACC ACA ACG AAU? AAC AAA AAGS AGUS AGCJ AGAL AGGS GUU...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’. Using the...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Please answer number 21-25, explain and clearly indicate which number you are answering. Thanks in advance!...
Please answer number 21-25, explain and clearly indicate
which number you are answering. Thanks in advance!
(Q21-25) We have the following double-stranded
DNA sequences, which codes for a 10 amino acid long protein gene.
Use the codon table and answer the questions.
5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3'
3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5'
21. Which strand codes for this protein?
A. top
B. bottom
C. both strands
D. none of the above
22. If this is a eukaryotic gene, which RNA polymerase
will make mRNA?
A. RNA Pol I...
Follow the instructions below to answer questions about Replication, Transcription & Translation. 3’- T A C...
Follow the instructions below to answer questions about
Replication, Transcription & Translation.
3’- T A C A
C C G G
T C A G
G T G A T C
-5’
A. Imagine that the sequence shown represents one strand of a
gene sequence. What would be the sequence of the complementary
strand of DNA? Write out your answer, indicating correct
polarity (5' and 3' ends) on your new strand. (1.5
points)
B. Now imagine that the new strand...
18 please 18a. The DNA is mutated on the 4th nucleotide (see bases in box) to...
18 please
18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC TCT CTG TGA 3» 18b. (2pts) Does this mutation change the amino acid sequence? If yes - what is 18c. (2pts) Can this mutation change the way the protein functions? 18d. (2pts) How can a DNA mutation change protein function? Explain your answer in terms of gene expression. 15. Answer the...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
(CHO)n- CH1403a-C7H1407 C7H107 cellulose and chitin- starch and glycogen-sucrose-galactose- maltose-fructose-fatty acids- polymer-monomer-saturated- unsaturated-glycerol- glycogen-collagen hemoglobin-ribose- nitrogen...
(CHO)n- CH1403a-C7H1407 C7H107 cellulose and chitin- starch and glycogen-sucrose-galactose- maltose-fructose-fatty acids- polymer-monomer-saturated- unsaturated-glycerol- glycogen-collagen hemoglobin-ribose- nitrogen base- chitin-phosphate group-insulin-pentose sugar-carbon- nitrogen- hydrogen-phosphorus- steroids- hydrolysis- dehydration-hydrogen bond- covalent bond-peptide bond- disulfide bond-guanine-cytosine- adenine-thymine- uracil-van der Waals-hydrophobic- sugar and phosphate bond- 1.A is a large organic molecule that contains repeating subunits called 2. A has fatty acids with double bonds, is liquid at room temperature and comes from a plant source. 3. Amino acids are joined together by bonds. 4. All molecules...
QUESTION 8 Using the altered mRNA and the genetic code, provide the sequence of amino acids in the peptide chain created. c A G UUU UẬC Phe UUA UAU Ty lucccys UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CUU CUC Leu CUA CCA Pro CUG CACCI CCG) ACU ACC ACA ACG sucu suco DUCU BUCO AUU AUC File AUA AUG Met GCU GCC GAC ASP GCA GUG GCG) GAG GUGGAGI GGG) Click Save and Submit to...
D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...
The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...
Extra Credit Assignment Use the Table and information below to answer the questions Second letter U C A UCA UUG/Leu บบบโphe UCU) UAUITVE UGUlays UCC Isor UAC JTyr UGC Cys Ser UUA UAA Stop UGA Stop UAG Stop UGG Trp CUU CAULHis CGU) CUC CAC CGC CUA CCA Pro CAA CGA CUG) CCG CAGS CGG СС First letter DUCUDUCUDUCUDUCU Third letter AUU AUC lle AUA AUG Met ACU ACC ACA ACG AAU? AAC AAA AAGS AGUS AGCJ AGAL AGGS GUU...
A template strand of DNA in a gene reads 3’ CCA AGC TCT 5’.
Using the codon chart provided, answer the following
questions:
-What is the sequence of amino acids that is produced when this
gene is translated?
-If a mutation causes a substitution (an A instead of a T) 3’
CCA AGC ACT 5’, what effect will it have on the mRNA transcript AND
on the protein?
-What do we call this type of mutation?
Second letter U С...
Please answer number 21-25, explain and clearly indicate
which number you are answering. Thanks in advance!
(Q21-25) We have the following double-stranded
DNA sequences, which codes for a 10 amino acid long protein gene.
Use the codon table and answer the questions.
5'-CCTGTGTCACTCACAGGGGATGGTATCACAGTGAGTCATGGGTTT-3'
3'-GGACACAGTGAGTGTCCCCTACCATAGTGTCACTCAGTACCCAAA-5'
21. Which strand codes for this protein?
A. top
B. bottom
C. both strands
D. none of the above
22. If this is a eukaryotic gene, which RNA polymerase
will make mRNA?
A. RNA Pol I...
Follow the instructions below to answer questions about
Replication, Transcription & Translation.
3’- T A C A
C C G G
T C A G
G T G A T C
-5’
A. Imagine that the sequence shown represents one strand of a
gene sequence. What would be the sequence of the complementary
strand of DNA? Write out your answer, indicating correct
polarity (5' and 3' ends) on your new strand. (1.5
points)
B. Now imagine that the new strand...
18 please
18a. The DNA is mutated on the 4th nucleotide (see bases in box) to the follo DNA :3TAC GCT GAG AGA GAC ACTS sº ATG CGA CTC TCT CTG TGA 3» 18b. (2pts) Does this mutation change the amino acid sequence? If yes - what is 18c. (2pts) Can this mutation change the way the protein functions? 18d. (2pts) How can a DNA mutation change protein function? Explain your answer in terms of gene expression. 15. Answer the...
Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...
(CHO)n- CH1403a-C7H1407 C7H107 cellulose and chitin- starch and glycogen-sucrose-galactose- maltose-fructose-fatty acids- polymer-monomer-saturated- unsaturated-glycerol- glycogen-collagen hemoglobin-ribose- nitrogen base- chitin-phosphate group-insulin-pentose sugar-carbon- nitrogen- hydrogen-phosphorus- steroids- hydrolysis- dehydration-hydrogen bond- covalent bond-peptide bond- disulfide bond-guanine-cytosine- adenine-thymine- uracil-van der Waals-hydrophobic- sugar and phosphate bond- 1.A is a large organic molecule that contains repeating subunits called 2. A has fatty acids with double bonds, is liquid at room temperature and comes from a plant source. 3. Amino acids are joined together by bonds. 4. All molecules...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago