Question

Please answer only if you know how to!!!

On the next page is a small segment of DNA that includes one gene. The list below contains all th e information that must be encoded in that gene in order for both transcription and translation to occur correctly 1. On the DNA, LABEL the location of every item on the list. Hint: some locations will be approximate 2. In the space provided below the gene, draw the mRNA that would be produced Hint: make sure its the right size, the correct # of strands (single or double?) and aligned with the DNA to show its relationship to the information located there. 3. LABEL all items from the list that are still present on the mRNA 4. In the space provided below the mRNA, draw the primary amino acid sequence of the polypeptide as a string of dots. Once again, make sure its the right size and aligned with the mRNA to show its relationship to the information located there. 5. LABEL any items from the list that are still present on the amino acid sequence. Information List 1. Transcription start 2. Transcription stop 3. Translation start 4. Translation stop 5. Promoter 6. Stop codon 7. Start codon 8. Coding strand 9. Template strand 10. Ribosome binding site 11. 3end 12. 5end

Please follow the directions and label clearly!

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Please answer only if you know how to!!! Please follow the directions and label clearly! On...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • I have my own answers, i just want to check my work, thanks! Given the DNA...

    I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...

  • 6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...

    6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...

  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected...

    Exam Practice Questions: L09-11 1. Fill in each blank with the best word or phrase selected from the list below. Not all words or phrases will be used; each word or phrase should be used only once. promoter translation pause site RBS sigma factor tmRNA RNA polymerase stop codon transcription Rho factor ribosome start codon DNA polymerase attenuation tRNA The first step in gene expression is by to make an mRNA that encodes for one or more proteins. This requires...

  • Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...

    Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.

  • 6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5...

    6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...

  • 5. Hemoglobin is the protein found in red blood cells that transports oxygen from your lungs...

    5. Hemoglobin is the protein found in red blood cells that transports oxygen from your lungs to your cells. Below is a segment of the DNA sequence that codes for a normal hemoglobin protein (the entire gene is much longer). Using the DNA sequence provided, transcribe the sequence into mRNA. Use the bottom strand as the coding strand. 5' ACTGCCCATGGTGCAC CIGACTCCTGAGGAG 3' 3' TGAC GG GIACCA CGT GGA CIGAG GACTCCTC 5 6. For hemoglobin, translate the mRNA strand from step...

  • Answer please? The sequence below represents a middle section of the template strand of DNA of...

    Answer please? The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3 CATGGACAGgtaagaatacaacacagGTCGGCATGACG 5' What would be the immature RNA...

  • 1. Explain the difference between spontaneous and induced mutations. Give an example of how each might...

    1. Explain the difference between spontaneous and induced mutations. Give an example of how each might be caused 2. For the double stranded DNA molecule shown below, the BOTTOM strand is the template for transcription. The START CODON is AUG and the STOP CODON IS UAA. a) Draw the mRNA transcript that would be made from this DNA molecule. b) Translate the mRNA and show the amino acid sequence of the encoded protein. 5’-AGGTCCAGTCTTCGGCGGATGATCGGGTCAAACCCGGGGTAACTGGTCACCGGCATCC-3’ 3’-TCCAGGTCAGAAGCCGCCTACTAGCCCAGTTTGGGCCCCATTGACCAGTGGCCGTAGG-5’

  • Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe...

    Summarize the relationship between genes and proteins . Explain the purpose of transcription and translation. Describe the steps of transcription I State the enzyme or structures that perform transcription and translation. Contrast prokaryotic and eukaryotic mRNA . Describe the process of translation .Describe the role of tRNA in translation . Explain the role of codons and anticodons in translation. Explain the significance of stop codons and start codons. Given a double stranded DNA gene sequence, be able to produce the...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT