Question

BIO 332: BIOINFORMATICS Exercise 2: An Exercise on Sequence Alignment In the codes of life, mutation events are observed as substitution, insertion, deletion. The following are amino acid sequences of pancreatic ribonuclease from three different species. Establish homology manually and show manually and show your alignment, then answer the following questions. Given SPECIES 1 KESPAAMKFEROHMDSGSTSSSNPTYCNOMMKRRNNTOGWCKPVNTFVHEP SPECIES 2 SPECIES 3 KESEAMKGEROHMPSGSTSSNPTYCNQMMKRFNMTOGWCKPPVNTFVVHEP SHOW YOUR ALIGNMENT BELOW:
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The alignment of amino acid sequences of the given three species is described in the diagram. There are two homologous alignment in the three given sequences as shown below.

2 Sequenu O CD 9刨

Add a comment
Know the answer?
Add Answer to:
BIO 332: BIOINFORMATICS Exercise 2: An Exercise on Sequence Alignment In the codes of life, mutation...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A....

    The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A. Give the mRNA codons and tRNA anticodons that correspond with this sequence. B. Using the above piece of DNA, show a deletion, insertion, a substitution, and nonsense mutation. Which ones are frame-shift mutations? Are any of your mutations missense? Use the table of codons and amino acids in the textbook to answer this part of the question. For microbiology

  • Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...

    Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...

  • D) Consider that during replication of the cell. the following mutations were generated within the gene...

    D) Consider that during replication of the cell. the following mutations were generated within the gene sequence. Find the mutation (in bold Italics-underlined Specify the protein sequences for each mutant sequence. mutation type 1: This is a non-sense mutation because the codon does not code for an amino acid any more 5' -..AACTAATGCCGTAAGACGTATTTTGACTAAT..-3' (substitution of a C 7 A in codon 3) 3'- TTGATTACGGCAT ICTGCATAAAACTGATTA..-5 S mutation type 2: This is a missense mutation because the codon now codes for...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • Week 14- Chapter 21 Homework Problem 21.72 < 52 of 58 Review Constants| Periodic Table Part A How does a point mutation for an enzyme affect the order of amino acids in that protein? Drag the term...

    Week 14- Chapter 21 Homework Problem 21.72 < 52 of 58 Review Constants| Periodic Table Part A How does a point mutation for an enzyme affect the order of amino acids in that protein? Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help then the order of amino acids will change in the of the polypeptide chain If the resulting codon still codes for the same amino acid, If the...

  •    Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented...

       Problem 2: Sequence similarity measure. Let 3 and y be two given DNA sequences, represented as strings with characters in the set {A, G, C,T}. The similarity measure of r and y is defined as the maximum score of any alignment of r and y, where the score for an alignment is computed by adding substitution score and deletion and insertion scores, as explained below. (Some operations have negative scores.) The score for changing a character T, into a...

  • Need some help with an exercise in my biology course. & Genetic Mutations X 2. Lab12....

    Need some help with an exercise in my biology course. & Genetic Mutations X 2. Lab12. eScience Transcription X + Chapter 13.2 х /sites/default/files/V3/Biology/2nd_Edition General_Biology/Docs/GB_1713_L12 Transcription_and_Translation/GB_1713_112_Exp2 Mutations.pdf Exercise Genetic Mut Experiment Inventory Materials No materials required EXERCISE 2: GENETIC MUTATIONS 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU VUA GAU GUA GCC CUU AGU GAU GUU UAG 12. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU VUA GAU...

  • Any help would be appreciated! S y of a protease activity of Science you decided to...

    Any help would be appreciated! S y of a protease activity of Science you decided to develop a series of peptide sequence to probe sequence versus activity profiles. boa experimenting the lo n g e sequence versus activity profiles You deseo DNA plecamid sequence entire plasmid not shown-just the ce desired Answer the e plasmid not show-just the site of interest and DNA questions using these sequences (24 pts) Plasmid Sequence (selected insert portion)" TCGAGCCGATATCCTGCAGCGATGAAGCTTGOTAGOGTCGACTAACACTGCAGOTCOACCO AGCGCTATAGGACOTCGCTACTTCGAACCATCGCAGCTGATTGTGACGTCCAGAR rege Althe t he...

  • For this assignment, we will consider a protein expressed in the liver of an African cheetah...

    For this assignment, we will consider a protein expressed in the liver of an African cheetah (Acinonyx jubatus). Biochemists determined that this protein is involved in the production of glycogen. In a stunning announcement, a snowboarder in Antarctica claims to have found a new species of cheetah that is able to survive freezing temperatures and a long, dark winter. The snowboarder described a slow, fat, white-furred cheetah that may be related to the African cheetah. Scientists isolated a fragment of...

  • Overview The purpose of this activity is to help the students to understand how replication, tran...

    TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT