Question

For this assignment, we will consider a protein expressed in the liver of an African cheetah...

For this assignment, we will consider a protein expressed in the liver of an African cheetah (Acinonyx jubatus). Biochemists determined that this protein is involved in the production of glycogen.

In a stunning announcement, a snowboarder in Antarctica claims to have found a new species of cheetah that is able to survive freezing temperatures and a long, dark winter. The snowboarder described a slow, fat, white-furred cheetah that may be related to the African cheetah. Scientists isolated a fragment of DNA from the obese feline creature which codes for the liver protein:

(3' end) ...CTACGTTCAGCTTGTCACGACTGGTTA... (5' end)

(5' end) ...GATGCAAGTCGAACAGTGCTGACCAAT... (3' end)

At almost the same time, a sleek, fast, white-coated cheetah was found in the Andes in South America where cheetahs were not known to exist. With some difficulty, a geneticist convinced the cheetah to allow her to swab the inside of the big cat's cheek to get a sample of DNA. Soon after, the geneticist was able to isolate the following DNA fragment believed to be involved with glycogen production in the liver:

(3' end) ...TCACCTACGTTCAATAGGTCACGACTGG... (5' end)

(5' end) ...AGTGGATGCAAGTTATCCAGTGCTGACC... (3' end)

The original African cheetah DNA fragment describing the liver protein in question is this:

(3' end) ...CACCTACGTTCAGGAGGTCAGGACTGGTTA... (5' end)

(5' end) ...GTGGATGCAAGTCCTCCAGTCCTGACCAAT... (3' end)

You are part of a team of geneticists, evolutionary biologists, and bioinformatics experts. You will attempt to describe the differences between the three species of cheetah in both genetic and evolutionary terms.

1)For each DNA sequence, transcribe to mRNA and then find the chain of amino acids that it produces. Remember that a gene must begin with the "Start" codon.

2)Describe the differences in the basic genetic code between the three species. How many DNA point mutations would be required to change from one species to the others? How do the amino acid sequences of the proteins differ? Are there any silent mutations that may not effect the function of the protein?

3)Looking at the amino acid substitutions that exist between the species, would you expect there to be large functional differences between the two slightly different proteins based on the properties of the substituted amino acids? Explain why you think this might be the case.

4)Quantitatively assess the evolutionary distance between each pair of the three species using the substitution matrix and PAM scores. (This involves three pairs: African/Andes, African/Antarctic, and Antarctic/Andes.)

5)Propose a scenario describing how the two new cheetah species might have evolved from the African cheetah. Were the two new cheetahs once a single species which then branched to form two separate species? Or did they evolve independently from the African cheetah? Be sure to include in your scenario how the new cheetahs managed to move from Africa to their present locations. Estimate a relative time line for each separate speciation event. (A speciation event is the genetic or environmental event that results in the creation of a new species.) How might the three proteins explain the survivability of the three species in their native habitat? (A little speculation is OK here. You are presenting a hypothesis based on the available evidence. Further research would be required to prove your hypothesis.)

HELP IS APPRECIATED

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. DNA from the obese feline creature-

DNA (3' end) ...CTA CGT TCA GCT TGT CAC GAC TGG TTA... (5' end)

mRNA 5' G AUG CAA GUC GAA CAG UGC UGA CCA AU 3'

amino acid Met Gln Val Glu Gln Cys STOP

DNA fragment for glycogen production in the liver-

DNA (3' end) ...TCACCTACGTTCAATAGGTCACGACTGG... (5' end)

mRNA 5' AGUGG AUG CAA GUU AUC CAG UGC UGA CC 3'

Amino acid Met Gln Val Ile Gln Cys STOP

Original African cheetah DNA fragment:

DNA (3' end) ...CACCTACGTTCAGGAGGTCAGGACTGGTTA... (5' end)

mRNA 5' GUGG AUG CAA GUC CUC CAG UCC UGA CCAAU 3'

Amino acid Met Gln Val Leu Gln Ser STOP

Add a comment
Know the answer?
Add Answer to:
For this assignment, we will consider a protein expressed in the liver of an African cheetah...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

    You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. Part A You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans....

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • Phylogeny is the evolutionary history of a species. a) Cytochrome C is an important mitochondrial protein...

    Phylogeny is the evolutionary history of a species. a) Cytochrome C is an important mitochondrial protein found in most organisms. The table below indicates the number of similarities in the amino acids found within Cytochrome C compared across five different species. Based on the data in the table, draw a phylogenetic tree that reflects the evolutionary relationships of the organisms based on the differences in their cytochrome c amino acid sequence. Based on the data, identify which species is most...

  • In humans, there are about 200 different types of cells. Why are your liver cells different...

    In humans, there are about 200 different types of cells. Why are your liver cells different from skin cells, or neurons, or muscle cells? During development, each cell accumulates different mutations changing their DNA They produce the same proteins but some of those proteins are denatured in each cell They have different DNA and thus, each cell produces different proteins They produce the same kind of proteins but not all proteins are active in each cell They have the same...

  • Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in...

    Chapter 15: 1. What is the significance of the fact that many synonymous codons differ in the third nucleotide position? 2. Define the following terms as they apply to the genetic code: a. Reading frame b. Overlapping code C. Nonoverlapping code d. Initiation codon e. Termination codon f. Sense codon 8. Nonsense codon h. Universal code i. Nonuniversal code 3. What role do the initiation factors play in protein synthesis? 4. Compare and contrast the process of protein synthesis in...

  • Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic...

    Prokaryotic mRNA usually encodes for more than one protein while eukaryotic mRNA a single protein. Eukaryotic DNA is linear and bacterial and archaeal DNA is-linear. In prokaryotes, ribosomes attach to the mRNA and start protein synthesis even before transcription is completed. Eukaryotic mRNA, rRNA, and tRNA are all highway processed. Nuclear pore complexes control the entry and exit to and from the nucleus. They will not let mRNA exit the nucleus before it is full processed. Eukaryotic and archaeal DNA...

  • 20. Protein amino acid side chains can hydrogen bond in the major groove of DNA, and...

    20. Protein amino acid side chains can hydrogen bond in the major groove of DNA, and discriminate between each of the four possible base pairs. In which one of the following groups of amino acids can all three members potentially be used in such DNA-protein recognition? A) Ala, Asn, Glu B) Arg. Gin, Leu C) Asn, Gin, Trp D) Asn, Glu, Lys E) Glu, Lys, Pro 21. Compared with DNA polymerase, reverse transcriptase: A) does not require a primer to...

  • You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and...

    You are studying the regulatory DNA of a mouse gene expressed in developing heart, liver, and lung tissue. Your preliminary work has shown that heart and lung expression of this gene is controlled by a short fragment of DNA just upstream of the promoter. Based on this result, you decide to investigate this region further to understand its function. You decide to compare this sequence to the regulatory DNA of the same gene found in rats and humans. Using genome...

  • QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated...

    QUESTION 6 Assume you are studying a protein-coding gene, ACEX, which includes 4 exons as illustrated in the gene map below. The 5' UTR and 3' UTR segments are each 25 bp long. Exons 1 thru 4 are 100, 200, 300, 400 bp long, respectively. Each intron is 200 bp each. The locations of the relevant EcoRI sites within the ACEX locus are indicated, but the location of other restriction enzyme sites (like BamHI) are not shown." EcoRI probe EcoRI...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT