Question

2) Recently the locus that controls fur color in cats has been identified. Two alleles for this locus (black and white) existECORE PMEI HIOTTI 6 W LADDER B w ם ם ם u son a) Compare the Black allele when cut with the three different restriction enzymea) Compare the Black allele when cut with the three different restriction enzymes. Why are the band sizes different in each o

0 0
Add a comment Improve this question Transcribed image text
Answer #1

ANSWER A and B :-

  1. For identifying the fragments that are being formed from the restriction digestion, it is very important to know the genetic sequence on the basis of which the restriction sites can be identified and analysed.
  2. Restriction fragment length polymorphism analysis can be used to detect single nucleotide transversions as can be seen in terms of replacement of Thymine to Guanine. The three different restriction sites for the enzymes may show variations in terms of formation of different sized bands.
  3. In case of HindIII, two bands are formed of size 8kb and 5kb respectively. In case of EcoRI, 3.5kb fragment is formed and in case of PmeI, a approximate 9.5kb fragment is formed. The difference in terms of band sizes may occur due to alteration of the restriction sites due to base transversion event which may inhibit recognition and thus cleavage of the sequence. The latter two restriction enzymes leads to formation of only single bands indicating a single DNA sequence which should have a size larger than that of the combined total of the two bands digested by HindIII. But, the single bands formed by digestion with EcoRI and PmeI lead to formation of a combined total size of around 13kb although the restriction site varies for both sequences. Three separate lanes indicates specific cleavage with three restriction enzymes otherwise they would have been marked in a single lane.
  4. HindIII recognizes the site A-AGCTT/TTCGA-A, EcoRI recognizes the site G-AATTC/CTTAA-G and PmeI indicates the site G-TTTAAAC/CAAATTT-G. The transversion specifically in case of the restriction sites of enzymes EcoRI and PmeI shows changes at the cleavage nucleotide sequence where the Thymine nucleotide is located. If the sequence of the alleles for the gene loci is known, then this can be used to spot the single nucleotide polymorphism. Hybridization with probe DNA leads to recognition of the sequence associated with the locus. Sites with alterations would show less specificity towards the probe which can be reflected in case of restriction enzymes EcoRi and PmeI.

Note :- Respected Sir, Its very important for the DNA sequence to be mentioned to identify the changes happening and at the same time to identify the probe sequence. The relation of polymorphism in terms of transcribed and untranscribed region can be derived through the phenotypic appearance. Taking into consideration there are changes associated with the DNA recognition sites for EcoRI and PmeI, there would be phenotypic changes detection in terms of the fur appearance. Please provide more details if possible and provide an upvote if the answer seems satisfactory.

Add a comment
Know the answer?
Add Answer to:
2) Recently the locus that controls fur color in cats has been identified. Two alleles for...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • In cats with tortoiseshell coat color, the fur is white with patchy black and orange spots....

    In cats with tortoiseshell coat color, the fur is white with patchy black and orange spots. In cats, the tortoiseshell gene is on the X chromosome, and the tortoiseshell phenotype requires the presence of 2 different alleles at this locus: one for orange fur (o) and one for black fur (b). What phenomenon best explains why female cats can inherit tortoiseshell coat color? In females, the alleles for coat color are pleiotropic, resulting in patches of orange and black coat...

  • Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or...

    Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or several of their paws. It results from a mutation in Gene T. Section of the wild type and polydactyly alleles contain the following sequence: Wild type Allele (T): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAAGCTTAGGTAGGTAGTTCGTA Polydactyly Allele (t): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAATCTTAGGTAGGTAGTTCGTA You are a geneticist and would like to test a litter of kittens. After isolating the DNA, you plan to cut it with a restriction enzyme and run the fragments on...

  • In a population of mice a particular locus has two alleles A1 (dominant) and A2 (recessive)....

    In a population of mice a particular locus has two alleles A1 (dominant) and A2 (recessive). There are 126 A1A1, 167 A1A2 and 88 A2A2. Is this population in Hardy-Weinberg equilibrium (3 pts)? In a population of Gragons, there are 3151 A1A1, 1678 A1A2 and 2014 A2A2 individuals. If the environment changes so that the homozygous recessive genotype suffers a reduction of fitness where its fitness is now 0.73, but the other genotypes are unaffected, what will be the frequency...

  • Part 2: Introduction to a GWAS Now, let’s explore how a GWAS works using a simple...

    Part 2: Introduction to a GWAS Now, let’s explore how a GWAS works using a simple example with just a small number of loci to examine (when this is done for real, computers are needed and thousands of loci can be tested for these associations). Scientists compare the SNPs in two groups of dogs: dogs with white fur and dogs with black fur. If one type of SNP is found much more frequently in dogs with white fur than in...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT