ANSWER A and B :-
Note :- Respected Sir, Its very important for the DNA sequence to be mentioned to identify the changes happening and at the same time to identify the probe sequence. The relation of polymorphism in terms of transcribed and untranscribed region can be derived through the phenotypic appearance. Taking into consideration there are changes associated with the DNA recognition sites for EcoRI and PmeI, there would be phenotypic changes detection in terms of the fur appearance. Please provide more details if possible and provide an upvote if the answer seems satisfactory.
2) Recently the locus that controls fur color in cats has been identified. Two alleles for...
In cats with tortoiseshell coat color, the fur is white with patchy black and orange spots. In cats, the tortoiseshell gene is on the X chromosome, and the tortoiseshell phenotype requires the presence of 2 different alleles at this locus: one for orange fur (o) and one for black fur (b). What phenomenon best explains why female cats can inherit tortoiseshell coat color? In females, the alleles for coat color are pleiotropic, resulting in patches of orange and black coat...
Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or several of their paws. It results from a mutation in Gene T. Section of the wild type and polydactyly alleles contain the following sequence: Wild type Allele (T): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAAGCTTAGGTAGGTAGTTCGTA Polydactyly Allele (t): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAATCTTAGGTAGGTAGTTCGTA You are a geneticist and would like to test a litter of kittens. After isolating the DNA, you plan to cut it with a restriction enzyme and run the fragments on...
In a population of mice a particular locus has two alleles A1 (dominant) and A2 (recessive). There are 126 A1A1, 167 A1A2 and 88 A2A2. Is this population in Hardy-Weinberg equilibrium (3 pts)? In a population of Gragons, there are 3151 A1A1, 1678 A1A2 and 2014 A2A2 individuals. If the environment changes so that the homozygous recessive genotype suffers a reduction of fitness where its fitness is now 0.73, but the other genotypes are unaffected, what will be the frequency...
Part 2: Introduction to a GWAS
Now, let’s explore how a GWAS works using a simple example with
just a small number of loci to examine (when this is done for real,
computers are needed and thousands of loci can be tested for these
associations). Scientists compare the SNPs in two groups of dogs:
dogs with white fur and dogs with black fur. If one type of SNP is
found much more frequently in dogs with white fur than in...