**Sequence above: ATGGCTAACTATCCACAGTTAAACAAAGAAGTACAACAAGGTGAAATCAAAGTGGTTTGA
Homework Answers
Answer:
First sequence:
TGA--DNA
ACU--mRNA
Thr----AA
Second sequence:
AGA--DNA
UCU--mRNA
Ser----AA
Due to change in the single nucleotide, the amino acid was changed from threonine to serine. So it is called missense mutation.
Add Answer to:
**Sequence above:
ATGGCTAACTATCCACAGTTAAACAAAGAAGTACAACAAGGTGAAATCAAAGTGGTTTGA
Compared to the first sequence above what is/are the consequence(s) of the nucleotide...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence...
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence provided in the old DNA strand. Old Strand: ATGGCTTAAGCCT O UACCGAAUUCGGA TACCGAATTCGGA O CGTTAGGCCTAAG CGTTUGGCCTUUG
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of...
1) The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... What is the nucleotide sequence of the DNA template strand from which it was transcribed? 2) If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes?
What is the nucleotide order of the conplimentary mRNA? What sequence of amino acids is coded...
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
central dogma question The nucleotide sequence below is from an individual. Only one strand of the...
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid...
In the process of __________, the nucleotide sequence in a mRNA molecule specifies the amino acid sequence of a protein. a) Transcription b) Translation c) Coding d) None of the above
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
A small section of a gene for a protein has the following nucleotide sequence: GGC TCG...
A small section of a gene for a protein has the following nucleotide sequence: GGC TCG GTA ACA TAC ______ 20. Which of the following mutations would cause a silent mutation in the sequence shown above? A. Replacement of second adenine base with thymine base B. Replacement of first thymine base with adenine base C. Replacement of first cytosine base with guanine base D. Replacement of second guanine base with cytosine base
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of...
What amino acid sequence does the following mRNA nucleotide sequence specify? 5′−AUGAACCUAUGC−3′ Express the sequence of amino acids using the three-letter abbreviations, separated by hyphens (e.g., Met-Ser-Thr-Lys-Gly).
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence?...
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence? Draw Conclusions: a. On the basis of the results obtained by the whole class, do you reject or accept your hypothesis?? b. What can you conclude about the effects of mutations?
What is the proper nucleotide sequence for the new mRNA strand based upon the nucleotide sequence provided in the old DNA strand. Old Strand: ATGGCTTAAGCCT O UACCGAAUUCGGA TACCGAATTCGGA O CGTTAGGCCTAAG CGTTUGGCCTUUG
What is the nucleotide order of the conplimentary mRNA? What
sequence of amino acids is coded by the DNA?
Question 1. For the following questions, use the genetic code in table 18.1. A DNA strand consists of 3'-TCAATACCCGCG-5'. What is the nucleotide order of the complimentary mRNA? What sequence of amino acids is coded by the DNA?
central dogma question
The nucleotide sequence below is from an individual. Only one strand of the chromosome is shown. Write the complementary strand of the DNA below. Watch your polarity! Below are two sequences, A and B. Both of these sequences are from the same gene from two different individuals. Differences in their sequence are highlighted red. What do these two sequences (A and B) represent? Now predict what a DNA gel of digested DNA from individual A and B...
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
d. What resemblance does the nucleotide sequence of tRNA anticodons bear to the original DNA sequence? Draw Conclusions: a. On the basis of the results obtained by the whole class, do you reject or accept your hypothesis?? b. What can you conclude about the effects of mutations?
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago