Individual A is Heterozygous , while B is Homozygous for the catalase-A locus.
Individual A has two bands while individual B has one band for the same locus so it explains that individual A is Heterozygous while B is Homozygous.
"A 26 base pair long sequence of DNA is known to bind only at the human...
The mutation that causes Huntington disease involves a DNA segment known as a CAG trinucleotide repeat. Normally, the CAG segment is repeated 10 to 35 times within the gene. In people with Huntington disease, the CAG segment is repeated 36 to more than 120 times. The trinucleotide repeat region of the HD gene from six individuals, each of whom has one parent affected by Huntington disease has been amplified by PCR and subjected to gel electrophoresis. The figure shows the...
2. PCR amplification of the TAS2R38 gene a. The number of copies of the 303 bp sequence grows exponentially (1-2-4-8-etc) after each cycle. The number of cycles we used is on page 97. What is the number of copies of the 303 bp fragment that will theoretically be present at the end of our reaction? b. Denaturation of the 303 bp segment of the TAS2R38 gene is a critical first step in the PCR perties of a DNA segment that...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
help with questions 5 to 10 please
PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...