
please help with these. if you answer all of them I'll
be sure to give a thumbs up.
please explain them so I can understand them, especially 28 and 26.
thanks!
I believe the correct answers to be as follows:
13) 1) A longer than normal mRNA would be produced.
26) 5) 5' GUA 3'
Because anticodon needs to be complimentary to the codon itself,
so if you reverse this sequence because 5' of the codon needs to
bind with 3; of the anticodon, you would get the attachment like
this:
5' GUA 3' (Anticodon)
3' CAU 5' (Codon)
28) 1,2,3 and 5
RNA is less stable as it has an hydroxyl group at 2' location which
makes it more reactive.
Rest of the options that are correct are just facts.
40)1) There will be a decrease in the amount of XYZ protein made.
feel free to leave a comment down below for any further query. good rating would be appreciated if you find my answer helpful. thank you.
please help with these. if you answer all of them I'll be sure to give a...
please answer all 6 questions
Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
As indicated in the image below, miRNAs usually have imperfect base pairing with their target mRNAs, which leads to translational inhibition (the RISC complex is large, and won't let ribosomes through). On the other hand, siRNAs produced from longer double stranded RNA molecules (e.g. viruses), usually show perfect binding to their target mRNAs, which leads to mRNA degradation by the RISC complex. In 100 words or fewer explain why these two types of inhibitory ncRNAs differ in their mode of...
13. Why are ribonucleoside triphosphates the monomers required for RNA synthesis rather than ribonucleoside monophosphates? A. Only ribonucleoside triphosphates contain the sugar ribose. B. Ribonucleoside triphosphates have low potential energy, making the polymerization reaction endergonic. C. Ribonucleoside triphosphates have high potential energy, making the polymerization reaction exergonic. D. Ribonucleoside monophosphates cannot form complementary base pairs with the DNA template. E. Ribonucleoside triphosphates are not used, rather all use deoxyriboside triphosphates. 14. How is a mutation in a bacterial cell that...
DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
Please give me a complete solutions, don't work on it if you're not going to finished this. This is an old homework, in which I am using to study for the exam. So please don't give me half ass answers. QUESTION 11 If a DNA segment has the sequence GCTAA, what RNA sequence will be made from it? a. CGATT b. CGUTT c. CGAUU d. GCTAA e. UGATT 1 points QUESTION 12 Which of the following brings amino acids...
When the structure of a DNA molecule is compared to a ladder, the uprights of the ladder are composed of sugars. phosphates. purine-pyrimidine pairs. If a DNA molecule containing the base sequence 5 CAGTTA 3 unzipped during replication, and replication that occurred in the direction away from the replication fork (to right) and proceeded in three-base sequences, what would be the FIRST three-base sequence to be formed? 5 TTA 3 5 CAG 3 3 TTA 5 3 GTC 5 5...
Answer the questions:
Question 1 Transcription begins at the..... a. operon o b. repressor c. genome 17d. promoter Question 2 0.5 points Save RNA is synthesized on a DNA template in a process called replication, DNA polymerase translation, RNA polymerase transcription, RNA polymerise t ranscription, DNA polymerase Question 3 Which eukaryotic RNA polymerase makes tRNA's? a RNA polymerase IIIb. Any of these RNA polymerase I od RNA polymerase II A Moving to another question will save this response. Question 4...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
You are growing cells in the lab and want them to express Protein X. You have added all necessary transcription factors (both general and specific and have checked all regulatory sequences for mutations (there are none). Still, transcription is not occurring. The best explanation for this would be... The cell is missing a HAT (histone acetyltransferase) O The cell is missing a DNA polymerase O The cell is missing an HMT (histone methyltransferase) The cell is missing an HDAC (histone...