Question

How do you seal sequence 2 (from 5'end) to the 3' end of the sequence 1 in vitro condition? Design a splint oligomer and write the all-possible content(s) needed for reaction to occur. Sequence 1: 5'ACTGTCGATGCTAGCTTGATCCAAGTATTGCTAG ACAGAATTGACATATAGGCGATGCTAGT3 Sequence 2: 5'ATCGCTAGGATCGCTAGATTTAAGTCGCTGATCG GCTAGATATAACAGGTCCTGAATCGCTA3

Answer 1

ANSWER :-

The two single stranded units can be linked by means of using T4 DNA Ligase method of ligation of the two strands of DNA. There is utilisation of an enzyme called as DNA Ligase which in the presence of ATP molecules is used to mediate the linkage.

The 5'- phosphate end of the sequence 2 is linked to the 3'-OH group of the sequence 1. The requirement for this experiment is ATP molecule, a splint oligomer sequence and the enzyme T4 DNA Ligase.

The construct of the splint oligomer is as follows :-

5'- CTACGATCA (There can be addition of either purine/pyrimidine) - Purine-Purine- 3'- OH

5' - Pyrimidine-Pyrimidine- TAGCGATCC - 3'

5' - CTACGATCA - P/P - P/P - P/P - A/G - A/G - T/C - T/C - TAGCGATCC - 3'

This above mentioned sequence will link to both the sequences which needs to be ligated acting as a splint oligomer in which there is complementary base pairing followed by activity of the DNA Ligase enzyme to mediated formation of Phosphodiester linkage between the two nucleotides one at the donor region and the other at the acceptor region.

NOTE :- Respected Sir/Madam, for any doubts, please prefer communicating through the comment section and please provide an upvote if the answer seems satisfactory.