Question

How do you seal sequence 2 (from 5end) to the 3 end of the sequence 1 in vitro condition? Design a splint oligomer and writ
0 0
Add a comment Improve this question Transcribed image text
Answer #1

ANSWER :-

The two single stranded units can be linked by means of using T4 DNA Ligase method of ligation of the two strands of DNA. There is utilisation of an enzyme called as DNA Ligase which in the presence of ATP molecules is used to mediate the linkage.

The 5'- phosphate end of the sequence 2 is linked to the 3'-OH group of the sequence 1. The requirement for this experiment is ATP molecule, a splint oligomer sequence and the enzyme T4 DNA Ligase.

The construct of the splint oligomer is as follows :-

5'- CTACGATCA (There can be addition of either purine/pyrimidine) - Purine-Purine- 3'- OH

5' - Pyrimidine-Pyrimidine- TAGCGATCC - 3'

5' - CTACGATCA - P/P - P/P - P/P - A/G - A/G - T/C - T/C - TAGCGATCC - 3'

This above mentioned sequence will link to both the sequences which needs to be ligated acting as a splint oligomer in which there is complementary base pairing followed by activity of the DNA Ligase enzyme to mediated formation of Phosphodiester linkage between the two nucleotides one at the donor region and the other at the acceptor region.

NOTE :- Respected Sir/Madam, for any doubts, please prefer communicating through the comment section and please provide an upvote if the answer seems satisfactory.

Add a comment
Know the answer?
Add Answer to:
How do you seal sequence 2 (from 5'end) to the 3' end of the sequence 1...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic...

    Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...

  • genetic biology 5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need...

    genetic biology 5'-GCATGAGTCTGGTACGCTTTTAAAGC-3' 3-CATGCG-5' IIIII 3. (a) in the sequence above, what enzyme would you need to extend the short stretch of nucleotides shown on the bottom strand? (b) Write the sequence of the newly synthesized fragment and label its S' and 3' end. (c) The covalent bond between these adjacent nucleotides is what type of chemical bond? After using a chemical mutagen to generate mutations in a DNA sequence, scientists noted a mutation from C to T at the...

  • 1. You are planning to study a gene ydeH from E.coli that encode for putative diguanylate...

    1. You are planning to study a gene ydeH from E.coli that encode for putative diguanylate cyclase activity (synthesis of a second messanger c-di-GMP). The in vitro enzymatic assay requires incubation of protein with GTP. List the steps involve in purification of protein. (hint : you need to clone the gene, express and purify the protein for in vitro assays.) 1a. Find the sequence of gene: Using NCBI or other database 2b. Design a strategy to clone and express the...

  • Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequ...

    Question 6. (20 points) You are designing a sequence detector that can detect 0110', if this sequence is detected, the detector output a 1'. Please consider 'overlap', which means that even if the sequence '0110 is detected, the detector still can reuse the history data. Design a Mealy FSM. 1) .(5 points) Draw the state transition diagram. 2) (2 points) How many states are there? How many bits are needed to encode the states? 3) -(4 points) Write down the...

  • 1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2....

    1. Which sequence of mRNA is produced from this DNA template: 3" A-T-A-G-C-T-A 5' ? 2. As a result of mutation, DNA sequence 5' A-G-A-T-G-A-C-T-G-A-A-G-T-C 3' changed into 5' A-G-A-T-G-A-C-T-G-A-G-T-C 3'. Which type of mutation is this? 3. What is the result of the following reaction" Fructose-6-phosphate + ATP (phosphofructokinase) -------> ? 4. Which steps of glycolysis are irreversible and used for its regulation (just step numbers are okay)? 5. What are the products of one turn of the citric...

  • A plasmid containing the sequence 5??GTCGGATCCTTA?3?3??CAGCCTAGGAAT?5? is combined with BamHI. Write the unpaired bases of the...

    A plasmid containing the sequence 5??GTCGGATCCTTA?3?3??CAGCCTAGGAAT?5? is combined with BamHI. Write the unpaired bases of the 5??3? sticky end, and then write the unpaired bases of the 3??5? sticky end from left to right as you read them on your screen. Express your answer as the sequence of the 5??3? sticky end followed by the sequence of the 3??5? sticky end separated by a comma (e.g., AGTGC,TCACG).

  • Design a synchronous sequential circuit that generates the repeating sequence of numbers O, 2, 1, 3,...

    Design a synchronous sequential circuit that generates the repeating sequence of numbers O, 2, 1, 3, O, 2, 1, 3, O, Indicate all the inputs and outputs that are required to realise such a circuit. Make a suitable state assignment to guide your design. Write a state transition table to assist in your design. Write a state excitation table to design the sequential circuit using D-type flipflops. Draw the final logic circuit that results from your design.

  • pre lab #2 & #3 vvith the end point of the titration, you can calculate the...

    pre lab #2 & #3 vvith the end point of the titration, you can calculate the number on" of sodium hydroxide delivered from the stoichiometry. LEARNING OUTCOMES 1. Understand the concepts of an acid-base reaction and titration 2. Know what the end point is and how it applies to stoichiometry 3. Determine the acetic acid content in vinegar 4. Demonstrate correct titration technique 5. Use group data to draw a conclusion of the "best buy" brand of vinegar PRE-LABORATORY ASSIGNMENT...

  • In part A, yes you should reconstitute the full-length protein sequence from the fragments. However, you...

    In part A, yes you should reconstitute the full-length protein sequence from the fragments. However, you do not need to write out the amino acid sequence - you can just provide the order of the fragment numbers (from either set of fragments). For example (and this is not the answer), you could say: "Using the Pro-IAPP fragment set, starting from the N-terminus, the fragment order is '5-4-6-3-2-1' " and that would fully address the question. In part B, the hint...

  • 3. In the lab today you prepared oxygen gas by decomposing hydrogen peroxide. There are many...

    3. In the lab today you prepared oxygen gas by decomposing hydrogen peroxide. There are many other chemical reactions that generate gases as one of their products. Lets consider the reaction between zinc metal and hydrochloric acid as such an example. a) (2 pts) What are the products of the chemical reaction that occurs when zinc metal is added to an aqueous solution of Hydrochloric acid? b) (3 pts) Write the chemical equation that represents this reaction? c) (4 pts)...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT