Question

1. you have isolated spontaneous mutations in the LEU6 gene of a haploid strain of the yeast S. cerevisiae. Some of your mutations result in a complete loss of LEU6 gene function. You reason that this phenotype may be due to insertion of a mobile DNA element into the gene.

To test this idea, you sequence the LEU6 region ion from several of your mutants and compare the DNA to the previously determined sequence for LEU6 in the parental strain. Numerous strains do in fact carry insertions, and a quick analysis indicates that several different types of mobile DNA elements are represented in the group of mutants.

Below is the sequence of one of the insertion mutations (Some sequences from the middle of the element deleted at the // symbol.) The sequence of the parental DNA at the insertion site is also shown.

Chromosome carrying insertion (inserted DNA sequences are in capital letters):

5’…tcgcagcgcatcgccttGAGCGGGACTCTGGGTATACGGATCCC//GTTTCGTATACCCAGAGTCCCGCTCgccttctatcgccttcttgacgagttcttct…3’

Chromosomal site:

5’…tcgcagcgcatcgccttctatcgccttcttgacgagttcttct…3’

You wish to determine if the insertion mutations are caused by: (1) a cut and paste transposon or (2) a retrovirus. Based on these data, which class or classes of elements are most likely responsible for the mutation in this isolate? Briefly explain.

Answer 1

Solu io The Corvech opton 1s ) a Cut and Paste +ransposc toe Can See in ve 가edwPeat's in He inserted ONA Sequences hence epton 3is not applicalile in Spite e the presence et targe sie duplication choose option mutaton issikely lo be caused by a Cu nd paste transpesno,