HomeworkLib
Question

9) DNA strands run 53 on one strand and 3 5 on the other strand. Therefore, DNA strands run 10) What does the cell use as
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

If you find anything disturbing ,ask me.

0 0
Add a comment
Know the answer?
Add Answer to:
9) DNA strands run 5'3' on one strand and 3' 5' on the other strand. Therefore,...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...

    DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'

  • DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the...

    DIN ANL and Protein Smith 6. Replicate each of the strands of DNA by moving the complementary nucleotides into place ONE AT A TIME, beginning at the end of each strand as shown in the photo 7. Compare the base sequences in the strands of these two new DNA molecules with each other, and also with the original strand. Are they identical molecules? 8. Point to the two strands of the original DNA molecule. Note that an original strand represents...

  • One of the DNA parental strands is 5’ ACCTCATCG 3’. The Boldface C was deaminated(and the...

    One of the DNA parental strands is 5’ ACCTCATCG 3’. The Boldface C was deaminated(and the mutation was not repaired). This strand does not get transcribed, the other one does. a) Predict the double stranded sequence of both dsDNA molecules made after one round of replication. Label the parental vs daughter strands in each ds molecule b) For each dsDNA mol (in part a) predict the RNA sequence if transcription occurred.

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • 3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...

    3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...

  • “Unlike what happens in DNA replication, where both strands are copied, only one of the two...

    “Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...

  • The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...

    The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.

  • Question 6: In the process of transcription, one of the DNA strands used is known as...

    Question 6: In the process of transcription, one of the DNA strands used is known as the template strand. The other, nontemplate strand is often referred to as the coding strand. Why do each of these names make sense? (i.e. What is the template strand a template for? What does the coding strand code for?) Lastly, how does this situation compare to the process of DNA replication? (i.e. What do we call the two strands in that case?)

  • Double stranded DNA consists of two long strands. An adenine on one strand is always paired...

    Double stranded DNA consists of two long strands. An adenine on one strand is always paired to a thymine on the opposite strand and a guanine on one strand is always paired to a cytosine on the opposite strand. If a purified DNA has 36% thymine, what arc the percentages of the other bases? A solution has 10 mu g/L of enzyme X, how much enzyme X is in each of the following amounts of solution. 100 mL 50 mL...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT