Question

4. Now consider the sequence that results for a different mutant protein. Using the DNA coding and sequence provided, predict
0 0
Add a comment Improve this question Transcribed image text
Answer #1

4. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, pred

Please rate high.

Add a comment
Know the answer?
Add Answer to:
4. Now consider the sequence that results for a different mutant protein. Using the DNA coding...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. Now consider the sequence that results for a different mutant protein. Using the DNA coding...

    3. Now consider the sequence that results for a different mutant protein. Using the DNA coding strand sequence provided, predict the sequences of the DNA template strand, mRNA, and polypeptide for the mutant gene. DNA coding strand for mutant gene 2: S'ACTGCCCLATGGTGTAG CTG ACTCCTGAGGAG13 On the line above, write the sequence for the template DNA strand, On the line below, write the sequence for the mRNA for mutant protein: On the line below, write the sequence for the Polypeptide for...

  • Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was...

    Given the template DNA sequence below: 3'-CCACCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' 6. An error occurred in DNA replication, A was incorporated in the place of T (indicated in yellow color in the aforementioned sequence) from the gene. Write the corresponding DNA template strand and transcribe the mutated mRNA strand, then determine the amino acid sequence of the mutant protein. If a stop codon is not present, create one by adding sequences to the gene and mRNA.

  • I have my own answers, i just want to check my work, thanks! Given the DNA...

    I have my own answers, i just want to check my work, thanks! Given the DNA sequence below: 3'-CGTCCTTCTATACTTCGCGGAATGCCGGTCCATGTAGGTTCACATTAGCGT-5' (Coding strand) 1. Replicate the corresponding template strand by using the aforementioned coding strand. Label the 5' and 3' ends in the new strand. 2. Transcribe the template strand to an mRNA sequence. 3. Find the start and stop codons on the mRNA and enclose it in a box or label with different color. 4. Write the amino acid sequence of...

  • Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’...

    Gene Expression Exercise Located below is a gene sequence from the coding strand of DNA 5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand. _________________________________________________ What would the mRNA be based upon the template strand above? mRNA___________________________________________ What would the primary linear structure of the protein be based upon the mRNA strand above? Intro to Biology 1005

  • You are given the following sequence of DNA which encodes for a short protein (this is...

    You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of...

    please help with #4 and #5 question 5 of 5 the cross lines indicate deletion of the nucleotides. what type of mutation is this? what is the resulting polypeptide sequence? 3'- GTT - TAC - CTT - -CTC--TCC -TCA -GAC - ATC -GCA -5' (template strand) 5' - CAA - ATG - GAA - -GAG--AGG - AGT - CTG- TAG - CGT - 3' (non-template/coding strand) answer: It's a ___________________mutation. Final polypeptide sequence is N' - Met - GLU _______________    ...

  • Shown below is the sequence of a coding strand of DNA that begins with what corresponds...

    Shown below is the sequence of a coding strand of DNA that begins with what corresponds to the translation start codon (AUG) in the mRNA transcript. You are analyzing two different mutants. Mutant #1 has an extra C residue after the underlined G residue and Mutant 2 has a deletion of the underlined A residue. Wild type 5’- ATGCTTACTGAGGTCATGGTACAGATGA Mutant 1 5’- ATGCTTACTGCAGGTCATGGTACAGATGA Mutant 2 5’- ATGCTTACTGAGGTCATGGTCAGATGA What is the amino acid sequence of the polypeptide encoded by: B. The...

  • The following double stranded segment of DNA is part of a protein coding gene. The segments...

    The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:

  • You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

    You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT