Question

5- UGUAUUAAAG CAUUUUUUUA GGAGGCAAUG GUAGAACCUU UUCUGGGGAG UGGGACAGAA UUGAUAUUUU CGCAAAAUUU AUUUCGCUAG AAUUUCUUUU CGAA-3 There is one open reading frame (ORFS) encoded within the mRNA sequence above (AUG start codon, ORF is on the top strand). Upstream of the coding sequence there is a ribosome binding site (Shine Dalgamo sequence AGGAGG) Q1. Find the ORF and ribosome binding site and change the font color of the ORF to blue and the font color of the ribosome binding site to red. (1 point) You have identified two small RNAS (SRNAS) and you want to determine if these SRNAS can influence expression of this gene. The sequences of the SRNAS are A. 5-ACCAUUGCCUCCUAAAAAAA-3 B. 5-UUCGAAAAGAAAU-3 Q2. Do these SRNAS have the potential to base pair with the MRNA? (1 point) Q3. Underline the region in the MRNA that each SRNA can bind to (4 points) A. 5-UGUAUUAAAG CAUUUUUUUA GGAGGCAAUG GUAGAACCUU UUCUGGGGAG UGGGACAGAA UUGAUAUUUU CGCAAAAUUU AUUUCGCUAG AAUUUCUUUU CGAA -3 B. 5-UGUAUUAAAG CAUUUUUUUA GGAGGCAAUG GUAGAACCUU UUCUGGGGAG UGGGACAGAA UUGAUAUUUU CGCAAAAUUU AUUUCGCUAG AAUUUCUUUU CGAA -3 Q4. Which of these SRNAS is most likely to influence protein production? Give reason(s) for your answer. (4 points)

Answer 1

Q1. The shine dalgarno sequence AGGAGG is marked in red below and the start codon AUG is marked in blue:

$image?w=624&h=60&rev=4&ac=1&parent=1X2_a$

Q2. Small RNAs are non-coding short RNA sequences that can be classified in to micro RNAs (miRNA), small-interfering RNAs (siRNA) and Piwi RNAs (piRNA).

miRNAs usually bind to the 3' UTR regions of mRNA and prevents translation of proteins.

siRNAs are double-stranded RNAs that target a specific mRNA and cleaves it by forming what is called an RNA induced silencing complex. This leads to post transcriptional gene silencing.

piRNAs are molecules that associate with what are known as Piwi proteins that together inhibit transposons involved in spermatogenesis.

single stranded sRNAs such as the miRNAs that have sequences complementary to that of an mRNA would base pair with the mRNA thereby disrupting the expression of the gene, much like the anti-sense RNA.

Q3. The region the given sRNAs bind to the sequence is shown below. Let us first write down the complementary sequences of sRNAs A and B:

Given sequence:

A. 5'- ACCAUUGCCUCCUAAAAAAA -3'

B. 5'- UUCGAAAAGAAAU -3'

Complementary sequence:

A. 5'- UUUUUUUAGGAGGCAAUGGU -3'

B. 5'- AUUUCUUUUCGAA -3'

Now we could locate these complementary regions in the given sequence below (underlined):

sRNA A:

$image?w=624&h=68&rev=4&ac=1&parent=1X2_a$

sRNA B:

$image?w=624&h=49&rev=4&ac=1&parent=1X2_a$

Q4. Both the sRNAs would block protein synthesis. sRNA A in the underlined region below actually is blocking the star codon here as well as the ribosome binding site. Hence translation would not take place.

sRNA B actually is bound to the 3' UTR region of the mRNA (see highlighted stop codon below) and is characteristic of miRNA that prevents translation of proteins once they bind to the 3' UTR , destabilizes the mRNA and causes translational silencing by a hitherto unknown mechanism .

$image?w=624&h=59&rev=52&ac=1&parent=1X2_$