5. The corresponding t - RNA base sequence is 5'-U-U-A-3'
Loops are present in the structure of t-RNA ,where hydrogen bonds are not formed. One of them is recognition loop,the most specific loop. t-RNA are different due this loop. A specific sequence of 3 nucleotides is present at the end of this loop. It is known as Anticodon. There are total 61 types of anticodon that means 61 types of t-RNA. t-RNA recognizes its place on m-RNA with the help of anticodon by recognizing its complementary sequence on m-RNA ,known as codon. UUA is complementary to AAU.
6. The role of tRNA during translation is to carry amino acids to the mRNA for correct placement into the polypeptide chain.
DHU loop of tRNA helps to recognize specific aminoacyl synthetase enzyme which activates specific amino acids and attach it to the 3' end of tRNA ,also known as acceptor arm. There are total 20 amino acids and tRNA are specific for each amino acid. tRNA carries amino acid to the mRNA according to the codon and then polypeptide bonds are formed.
Stop codon are 3 in number UAA, UAG, UGA. They are recognized by termination factors or release factors. No tRNA is able to recognize stop codons by their anti codons.
Protein synthesis occurs on ribosomes in the cytoplasm. Disruption of DNA helix during transcription is done by the enzyme which breaks the hydrogen bonds between two strands.


d. glycosidic bonds e. Both a and care correct answers. 05. If a portion of a...
Which of the following is not an essential function of ribosomes in all domains of life? A. Catalyze peptide bond formation between amino acids during polypeptide formation. B. Bind messenger RNA and identify the start codon where translation begins. C. Facilitate the complementary base pairing of mRNA codons and tRNA anticodons that determines amino acid order in the polypeptide. D. Align the Shine Delgarno sequence in the mRNA with a complementary sequence in the 16S rRNA of the small ribosomal...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
moose the correct alphabet (letter, noting that each and may have only ch answer can be used more than once Answers a Eukaryotic mRNAS b.Prokaryotic mRNAs e . Transfer RNAS d. RNAs f. All RNAS e. Pre-mRNA the have a cloverleaf structure are synthesized by RNA polymerases the RNA that has the anti-codon are the template of genetic information during protein synthesis contains exons and introns is a structural component of the ribosome is the RNA that goes into the...
1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...
1, If alternative splicing was not available, what impact would this have? Individuals would need more DNA to code for proteins Individuals would need less DNA to code for proteins Individuals would not be able to make different proteins from the same sequence of DNA Both A and C None of the above 2, An individual has a mutation that adds one base to the sequence of DNA. What type of mutation is this most likely to cause? Silent Mis-Sense...
help
7) In semiconservative DNA replication, each new double helix formed will have Atwo new strands and two old strands. Bone new and one old strand in each helix C)three new strands in one helix and three old strands in the second helix D)two new and one old strand in one helix and two old and one new strand in the second helix E two new strands in one helix and two old strands in the other helix. 8) A...
23. What ensures that the correct amino acid is added during translation? A. the methyl-guanosine cap of a properly modified mRNA B. transcription factors C. the anticodon of a properly formed aminoacyl tRNA D. the sequence of the coding strand E. all of the above 24. If the DNA code for a particular amino acid is 5'AGT3', then the anticodon on the tRNA would be A. 5'TCA3 B. 5'UCA3 C. 5'AGU3 D. 5'ACU3 E. 5'UCA3 25. What enzyme catalyzes the...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
8. Glycolysis is a(n). A) five-step B) aerobic process C) catabolic D) anaerobic 9. The overall process of glycolysis A) produces CO B) is an anabolic pathway C) uses up 4 ATP molecules. D) produces 2 ATP molecules. 10. In step 9 of glycolysis, 2-phosphoglycerate is converted to phosphoenolpyruvate by a(n) reaction ) hydrolysis D) oxidation A) elimination B) addition 11. The nucleotides in the backbone of DNA are held together by A) phosphodiester B) hydrogen bonds D) peptide C)...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...