miR-5 inhibits the translation of the UCD mRNA by binding to the 3` end of the mRNA, the UCD gene codes for a protein which is an allosteric activator of p101, in the cancer cells it is found that the activity of the p101 is misregulated, and the p101 is overactive, means the allosteric activator remains bound to the protein always so the UCD mRNA is translated always so the miR-5 which inhibits the translation of the UCD mRNA is not expressed, so the region of the chromatin which codes for the miR-5 is in the heterochromatin state.
histones are positively charged proteins, it is wrapped around the negatively charged DNA using electrostatic interaction, acetylation of the histone decreases the posiitve charge of the protein because the acetyl group is negatively charged, so the interaction between the DNA and the histones decreases and the DNA becomes loosely packed over the histones so the chromatin becomes euchromatin and the genes are expressed.here the expression of miR-5 is decreased so the region of the miR-5 is hyperacetylated.
The gene encoding miR-5 is in a region of chromatin with hypoacetylation.
The gene encoding miR-5 is in a region of heterochromatin
9) DNA methylation is decreased, means the p101 is inactive, so the allosteric activator of the p101 is produced at low levels, or absent
so the answer is the absence of UCD protein due to miR-5 inhibiting the translation of the UCD mRNA transcript.
Questions 8-9: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the...
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form In a lung cancer cell line, the p101 protein is overly active leading to misregulation of gene...
Question: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3’UTR of the mRNA transcript encoded by the ABC gene. The ABC gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form. A. In a lung cancer cell line, the p101 protein is overly active leading to misregulation of...
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form A different lung cancer cell line is found to have significantly decreased amounts of histone acetylation. Which...
Questions 3-4: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the mRNA transcript encoded by the BIS gene. The BIS gene encodes for a protein that acts as an allosteric inhibitor of the protein p101. Question 3 2 pts 4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS...
4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS gene expression remains unchanged in cells expressing miR-5 Transcription initiation of BIS is negatively regulated Question 4 2 pts 5.(2pts) Which of the following are true of p101 expression in these cells? o increased amounts of the p101 protein due to low levels of...
1. What transcript is produced from this gene?
5’ ATTGTGAGCAGGAAGAGAGT 3’
3’ TAACACTCGTCCTTCTCTCA 5’
A) 5’AUUGUGAGCAGGAAGAGAGU3’
B) 5’ACUCUCUUCCUGCUCACAAU3’
C) 5’UAACACUCGUCCUUCUCUCA3’
D) 5’UGAGAGAAGGACGAGUGUUA3’
2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it
bind?
3.The lac operon is ON in which situation:
A) Low glucose low lactose
B) Low glucose high lactose
C) High glucose high lactose
D) High glucose low lactose
4.You have isolated an E. coli mutant that has a deletion of the
gene encoding the...
please answer all the questions
Question 8
0 / 1 pts
Our understanding of RNA
was non-existent until 2000
started with the identification of a tRNA which suggested a
method of converting DNA to protein
began to identify that DNA-->protein--> RNA
stopped growing after it's original discovery in the 70s
IncorrectQuestion 10
0 / 1 pts
Enzymes allow for chemical reactions to occur in the cell that
may not naturally occur at the right place at...
please help!!
transcription? How could the presence of a hormone in the blood have an effect on this structure? 6 points 3. What is an enhancer region and why is it important in the regulation of eukaryotic Contents Cancer Genes that cause cancer are called oncogenes. d. promoter genes. a. operator genes. b. pseudogenes.c 2A mutation in which of the following genes would be LEAST likely lead to a cancer? a. growth hormone gene b. growth hormone receptor gene c....
For the questions below, be sure to write all oligonucleotide sequences 5'+3'. You are researching a rare human leukemia that is caused by a mutation in a small protein called Cdr (for Cell Division Regulator). It has been found that patients with this rare leukemia contain a mutation in the 5' untranslated region of cdr. The mutation is a GỮA transition at nucleotide 7 of the transcript. Human Chromosome G7A 5' (sense strand) sequence included in cdr transcript gtactgcctattatgcagtettataagaaactaggtgccatggccttgacaggttctattagacactgtcggttgggcagacataatgagtctctagttgatgggagacgaccacgctgtcagtaagtactttttgcettcttatgccgtaccgac DNA...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...