Question: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3’UTR of the mRNA transcript encoded by the ABC gene. The ABC gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form.
A. In a lung cancer cell line, the p101 protein is overly active leading to misregulation of gene expression. In these lung cancer cells which of the following would be a correct prediction in regards to miR-5? choose ALL that apply,
a. The gene encoding miR-5 is in a region of chromatin with increased DNA methylation
b. The gene encoding miR-5 is in a region with decreased DNA methylation
c. The gene encoding miR-5 is in a region of euchromatin
d. The gene encoding miR-5 is in a region of heterochromatin
e. The miR-5 transcript is translated at high levels
f. The miR-5 transcript is activating translation of the ABC gene
B A different lung cancer cell line is found to have significantly decreasedamounts of histone acetylation. Which of the following could explain why there is decreased histone acetylation in this cell line? choose ALL that apply
a. increased translation of the p101 protein due to low levels of miR-5
b. decreased translation of the p101 protein due to high levels of miR-5
c. increased translation of the ABC protein due to high levels of miR-5
d. decreased translation of the ABC protein due to low levels of miR-5
e. decreased translation of the ABC protein due to high levels of miR-5
f. the absence of the p101 protein due to miR-5 inhibiting transcription of the p101 mRNA transcript
g. the absence of the ABC protein due to miR-5 inhibiting transcription of the ABC mRNA transcript
a) miR-5 inhibits the expression of the ABC protein by degrading the mRNA of the ABC gene ( miRNA which is completely complementary to the mRNA leads to mRNA degradation using RISC), the ABC protein activates the p101 protein.
in the cell, the p101 is overactive means the ABC gene is translated all the time because miRNA-5 is not transcribed.
DNA methylation prevents transcription of the DNA, euchromatin is loosely packed so genes in the euchromatin is transcribed and heterochromatin is densely packed so genes in the genes in the heterochromatin is not transcribed.
so the answers are
a. The gene encoding miR-5 is in a region of chromatin with increased DNA methylation
d. The gene encoding miR-5 is in a region of heterochromatin
b) histone acetylation is decreased means the p101 is not active, so the levels of ABC protein is decreases, it is due to the increased expression of miRNA-5
so the answer is e. decreased translation of the ABC protein due to high levels of miR-5
for option g, the absence of the ABC protein due to miR-5 inhibiting transcription of the ABC mRNA transcript, the word transcription is used, if that is a typo and the original word is the translation, this option can be one of the answers.
( miRNA-5 does not change the translation of the p101 protein)
Question: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3’UTR of the mRNA...
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form In a lung cancer cell line, the p101 protein is overly active leading to misregulation of gene...
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form A different lung cancer cell line is found to have significantly decreased amounts of histone acetylation. Which...
Questions 8-9: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the MRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a DNA methyltransferase (DNMT) which is an enzyme that methylates DNA when the protein is in its active form. 8. 8. (1pt) In a lung cancer cell line, the p101 protein is overly active leading to...
Questions 3-4: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the mRNA transcript encoded by the BIS gene. The BIS gene encodes for a protein that acts as an allosteric inhibitor of the protein p101. Question 3 2 pts 4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS...
4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS gene expression remains unchanged in cells expressing miR-5 Transcription initiation of BIS is negatively regulated Question 4 2 pts 5.(2pts) Which of the following are true of p101 expression in these cells? o increased amounts of the p101 protein due to low levels of...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...
need to know if correct
44 F Nonsense-mediated mRNA decay refers to the degradation of introns after splicing 45. Exon skipping and cryptic splice-site selection are two types of splicing errors. 46. Transcription activators can promote nucleosome remodeling by recruiting histone modifying enzymes. 47. RNA polymerase Il terminates transcription precisely at the AAUAAA 48. During protein translation, Kozak consensus sequences are required for termination 49. In regards to transcription, DNA tooping refers to the removal of DNA looped around histone...
QUESTION 36 Ferritin is an intracellular protein that stores essential iron and releases it in a controlled fashion when needed. Hereditary hyperferritinaemia-cataract syndrome (HHCS) is a relatively rare disorder with an autosomal dominant trait. The disease is characterized by increased L-ferritin in serum and tissues and early onset of bilateral cataracts. Iron metabolism is normal, and there is no tissue iron overload. HHCS can be caused by mutations in the 5' non-coding region of the ferritin gene. Which of the...
please answer all 6 questions
Question 27 3 pts TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP? o Reduced siRNA-mediated mRNA degradation o Increased miRNA-mediated translational repression o Increased deadenylase-mediated mRNA degradation o Reduced proteasome-mediated protein degradation D Question 28 3 pts A protein that binds to the 3' UTR of a VEGF mRNA and promotes deadenylation and uncapping is likely to:...
Question 19 (3 points) Saved Choose all of the modifications to mRNA in eukaryotes. 5' methyl G cap splicing endonuclease 3' poly A tail exonuclease Question 21 (4 points) ✓ Saved Please put the following activities of translation initiation in order from first to last. 2 tRNA with anticodon UAC binds to mRNA codon AUG large subunit of ribosome binds to mRNA Small subunit of ribosome binds to mRNA 1 v A-site is open 3 Choose all the molecules that...