Question







In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

miR5 ----| UCD ------> p101 (HAT)

1. Options 1 and 4 are correct
The p101 protein is over-expressed i.e. miR5 should be repressed
i. Methylated DNA = Repressed gene
ii. False
iii. False: Euchromatin = Transcriptionally active
iv. True: Heterochromatin = Transcriptionally inactive
v. False: miR5 is a noncoding gene. It does not make a protein
vi. False: miR5 is a negative regulator of UCD gene

Add a comment
Know the answer?
Add Answer to:
In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA...

    In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3 UTR of the mRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form A different lung cancer cell line is found to have significantly decreased amounts of histone acetylation. Which...

  • Question: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3’UTR of the mRNA...

    Question: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3’UTR of the mRNA transcript encoded by the ABC gene. The ABC gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a histone acetyl transferase (HAT) which is an enzyme that acetylates histones when the protein is in its active form. A. In a lung cancer cell line, the p101 protein is overly active leading to misregulation of...

  • Questions 8-9: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the...

    Questions 8-9: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the MRNA transcript encoded by the UCD gene. The UCD gene encodes for a protein that acts as an allosteric activator of the protein p101. The p101 protein is a DNA methyltransferase (DNMT) which is an enzyme that methylates DNA when the protein is in its active form. 8. 8. (1pt) In a lung cancer cell line, the p101 protein is overly active leading to...

  • Questions 3-4: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the...

    Questions 3-4: In eukaryotes, miR-5 is a microRNA with sequence complementarity to the 3'UTR of the mRNA transcript encoded by the BIS gene. The BIS gene encodes for a protein that acts as an allosteric inhibitor of the protein p101. Question 3 2 pts 4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS...

  • 4. (2pts) Which of the following is true concerning expression levels of the BIS gene in...

    4. (2pts) Which of the following is true concerning expression levels of the BIS gene in cells expressing miR-5? BIS gene expression is increased in these cells BIS gene expression is decreased in these cells BIS gene expression remains unchanged in cells expressing miR-5 Transcription initiation of BIS is negatively regulated Question 4 2 pts 5.(2pts) Which of the following are true of p101 expression in these cells? o increased amounts of the p101 protein due to low levels of...

  • Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...

    Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron sites, poly-A adding site). Please also briefly describe the key steps taking place during RNA processing. For each step of...

  • need to know if correct 44 F Nonsense-mediated mRNA decay refers to the degradation of introns...

    need to know if correct 44 F Nonsense-mediated mRNA decay refers to the degradation of introns after splicing 45. Exon skipping and cryptic splice-site selection are two types of splicing errors. 46. Transcription activators can promote nucleosome remodeling by recruiting histone modifying enzymes. 47. RNA polymerase Il terminates transcription precisely at the AAUAAA 48. During protein translation, Kozak consensus sequences are required for termination 49. In regards to transcription, DNA tooping refers to the removal of DNA looped around histone...

  • Two identical twins who showed very similar methylation patterns when they were 4 years old show...

    Two identical twins who showed very similar methylation patterns when they were 4 years old show very divergent patterns at age 40. This divergence is most likely due to a different alternative splicing in the two individuals Ob different levels of histone acetyltransferase in the two individuals. Oc environmental differences that they experienced as adults. O d. different genomic imprinting in the two individuals. O e differences in their experiences in utero Suppose that a certain enzyme is synthesized whenever...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • The observation that in any DNA sample, A T and G C A. DNase sequencing An...

    The observation that in any DNA sample, A T and G C A. DNase sequencing An analytical method that determines which segments of DNA are bound by a particular B. Chargaff's rule protein factor, such as a transcription factor C. ChIP sequencing D. Euchromatin E. Histone acetylation F. major groove - # Areas associated with a eukaryotic gene that are where most DNA methylation occurs. # An analytical technique that involves a small slide or chip with many segments of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT