Homework Answers
Full form of DNA is deoxyribonucleic acid, which contain long chain of nucleotide ( deoxyribose sugar molecule+bases+phosphate group). Bases in DNA may be adenine, guanine, thymine and cytosine. Attachment of base to 1' position of sugar molecule and phosphate group to 5' position.
please
rate my answer thankyou.
Add Answer to:
3. Draw the phosphodiester backbone of a strand of DNA that is three nucleotides long, (You...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the...
Draw the chemical structure of the DNA trimer 5’-ACG-3’ hydrogen-bonded to its complementary strand. Include the deoxyribose rings and the phosphodiester backbones and show the H-bonding interactions between the bases.
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points ...
DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points QUESTION 5 Basic...
2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not...
2. (3 pts) Draw a gene! Draw only the template strand of the DNA. Do not draw the non-template strand. Label the 5' and 3' ends of the DNA. Label the promoter, coding region, and termination site. Draw RNA polymerase halfway through the process of transcription, and the RNA it has produced.
pls help The DNA sequence below is 300 bases long. This is only one strand of...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Below is a piece of a DNA strand. a How can you tell this is DNA...
Below is a piece of a DNA strand. a How can you tell this is DNA and not RNA? b Name the two bases shown. e Draw the coroplementary strand. Make sure to show the hydrogen bonding and draw the sugar phosphate bachyone.
draw replication bubble. ONLY IN ON SITE label the following. 1.leading strand 2.lagging strand 3.direction 5'...
draw replication bubble. ONLY IN ON SITE label the following. 1.leading strand 2.lagging strand 3.direction 5' 3' 4. DNA polymerase 5. RNA primer 6. okazaki fragments 7.binding protein 8.nucleotides 9.Sliding clamps 10. clamp loader 11.helicase 12.DNA gyrate 13.DNA helicase 14.DNA ligase DRAW COMPLETW BUBBLE AND ONLY LABEL ON ONE SITE. THANK YOU!
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA...
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...
a) Please draw the nucleotide sequence AC, from DNA; start at 5' and draw the backbone vertically down the page. Please draw a 5' phosphate and 3' hydroxyl. b) Please draw just the bases of the complementary strand, including a "squggle bond" to indicate the attachment to the ribose; mark hydrogen bonds with the standard dashed lines. c) Please label the bases of both strands with their names. d) Please explain why you would lose points in part c if...
pls help
The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...
Below is a piece of a DNA strand. a How can you tell this is DNA and not RNA? b Name the two bases shown. e Draw the coroplementary strand. Make sure to show the hydrogen bonding and draw the sugar phosphate bachyone.
2. The sequence below represents two DNA strands linked together by hydrogen bonds. The smaller DNA strand has a 3'-OH that will be used by the DNA polymerase to add nucleotides using the longer DNA strand as a template. You add dATP, SCTP, dTTP, and ddGTP (dideoxy-GTP); and incubate at the DNA polymerase optimum temperature to allow the extension of the smaller DNA strand. Using the symbols below, draw the extended DNA strand (you don't need to draw the template...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago