Which of the following is the process of copying the genome? * DNA replication conjugation translation...
Which of the following is the process of copying the genome? *
DNA replication
conjugation
translation
transcription
Homework Answers
OPTION A - DNA REPLICATION
DNA replication is the process by which DNA makes a copy of itself during cell division.The separation of the two single strands of DNA creates a 'Y' shape called a replication 'fork'. The two separated strands will act as templates for making the new strands of DNA.
Bacterial conjugation is the transfer of genetic material between bacterial cells by direct cell-to-cell contact or by a bridge-like connection between two cells.
Trancription is a process in which a particular segment of DNA is copied into RNA by the enzyme RNA polymerase.
Translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a sequence of amino acids during protein synthesis.
Add Answer to:
Which of the following is the process of copying the genome?
*
DNA replication
conjugation
translation...
1. Which of the following is more error prone? A) human genome replication b) RNA viral...
1. Which of the following is more error prone? A) human genome replication b) RNA viral genome replication c) DNA viral genome replication d) Canine genome replication e) the genetic diversity of virus 2. Which is Not a level of control for viral gene expression? A) Configuration of viral DNA or RNA b) At transcription c) at regeneration d) mRNA half-life e) at translation 3) which of the following defines the Baltimore scheme? A) a chart of DNA transcription mechanisms...
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate,...
Identify the components of replication, transcription, and translation processes. Replication transcription translation DNA polymerase, deoxynucleoside triphosphate, primer, RNA polymerase, nucleoside triphosphate, transfer RNA, ribosome, messenger RNA , promoter, ribosomal RNA
DNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication
Define termsDNA, RNA, nucleotides, plasmid, helicase, DNA polymerase, primase, RNA primer of DNA replication, mutation, gene, amino acid, polypeptide chain, protein, codon, promoter region of a gene, RNA polymerase, transcription, mRNA, tRNA, RNA, ribosomes, translation, gene expression, conjugation, conjugative pilus, transformation, transductionExplain concept or process• Describe how nucleotides are linked together to form a single strand of nucleic acid• Explain the concept of a complementary pairing • Describe how DNA replication occurs in bacteria • Explain why a primer is necessary for...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table...
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence...
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Make a concept map linking the following terms : transciption , translation, genome, gene, protein, genotype,...
Make a concept map linking the following terms : transciption
, translation, genome, gene, protein, genotype, phenotype,
replication, DNA, RNA, reverse transcriptase, helicase, ligase ,
DNA polymerase, RNA polymerase, primase, intron, exon, exome
please help and be clear !
Try to make a concept map linking the following terms: if you do not know what a concept map is go to https://www.youtube.com/watch?v=vuBL16ijHHg transcription translation - Ribotone, where translation takes place genome gene - small pice of Drun Inal codes prote....
Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means...
Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means the cellular process that must occur immediately before the one in the question. synthesis and secretion of insulin from the liver meiosis of spermatogonia production of LH mRNA in the pituitary gland mitosis of intestinal epithelial cells synthesis of steroid hormone receptors
Which term describes the process by which a single strand of DNA serves as a template...
Which term describes the process by which a single strand of DNA serves as a template for the synthesis of an RNA molecule? translation transcription initiation elongation replication
Which of the following is NOT true about bacterial conjugation An F factor drives replication and...
Which of the following is NOT true about bacterial conjugation An F factor drives replication and transfer of a conjugative plasmid The genome of the bacterial chromosome in the donor cells is altered through ectopic recombination Transfer is mediated by a tube-like pilus formed between the adjacent cells Mating cells often break apart before transfer of the entire bacterial chromosome. The transferred DNA can be incorporated in the recipient cell bacterial chromosome via homologous recombination.
3. Compare the key players in DNA replication, transcription, and translation by filling out a table such as this one (this is just a template, you will need more space than what’s provided here). Key players Replication Transcription Translation DNA components RNA components Protein components
Replication, Transcription, and Translation >> Use the provided DNA sequence to generate an amino acid sequence > Replication: use base pairing rules (A-T, C-G) to create a new strand of DNA Transcription: use the new strand of DNA to make a strand of RNA; don't forget that RNA uses U instead of T > Translation: use the genetic code to determine the amino acid sequence w BEUTE ZERBS 21 Second letter WAU) Tyr Urddon Stop UGI UAG Stop UGG Osclone...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
Make a concept map linking the following terms : transciption
, translation, genome, gene, protein, genotype, phenotype,
replication, DNA, RNA, reverse transcriptase, helicase, ligase ,
DNA polymerase, RNA polymerase, primase, intron, exon, exome
please help and be clear !
Try to make a concept map linking the following terms: if you do not know what a concept map is go to https://www.youtube.com/watch?v=vuBL16ijHHg transcription translation - Ribotone, where translation takes place genome gene - small pice of Drun Inal codes prote....
Indicate which cellular processes directly require DNA replication (R), transcription (TC), or translation (TL). 'Directly' means the cellular process that must occur immediately before the one in the question. synthesis and secretion of insulin from the liver meiosis of spermatogonia production of LH mRNA in the pituitary gland mitosis of intestinal epithelial cells synthesis of steroid hormone receptors
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago