20. c. To lysis cell
Inorder to cut the DNA it must be free from other macro molecules. Since the DNA is enclosed within the membranes we should lyse it to release DNA along with other macromolecules. Then only by treatment we can remove the other macromolecules. So, we use heat as the medium to lyse the cell and extract DNA.
21. c . Taq can tolerate DNA denaturation temperature.
Taq polymerase is used in the annealing procedure of PCR, It is isolated from bacterium, Thermus aquaticus , which can remain active even at high temperature i.e, can withstand high temperature 90oC, and can induce denaturation of asDNA.
(As you haven't mentioned which question to be answered , i am giving you only answer to these questions... Plz repost those questions if you need help in them ;)
20- In cheek DNA extraction procedure, what is the purpose of heating a. To speed up...
please!
Assay questions 5 points each 1-What RFLP stand for and what RFLP analysis test for? 2-Why do you add sample loading buffer to DNA sample prior to loading sample into agarose gel. 3-In cheek DNA extraction procedure, name two steps that helped to break (lysis) the cheek cells. 4- Would a shorter DNA fragment move faster or slower through agarose gel, why.
nomal No Spac... Heading 1 Paragraph JULLL HDBl AaBbCcDAoBbced Heading 2 Title Subtitle Subtle Em Styles 1-What RFLP stand for and what RFLP analysis test for? 2-Why do you add sample loading buffer to DNA sample prior to loading sample into agarose gel. 3 In cheek DNA extraction procedure, name two steps that helped to break (lysis) the cheek cells. 4. Would a shorter DNA fragment move faster or slower through agarose gel, why.
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Why do restriction enzymes need to be kept on ice? What order should the DNA, enzyme, water and buffer be added to the microcentrifuge tube for a restriction digest? If lambda DNA is linear, how many times would the enzyme have to cut the DNA to generate five DNA fragments? Would a shorter DNA fragment move faster or slower through the agarose gel than a longer fragment? Why?
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
And..
Exercise1:
Give the basic steps involved in extracting genomic
DNA from animal cells and tossues?
23- Which of the following statements is correct? a. Longer DNA fragments migrate farther than shorter fragments. b. Migration distance is inversely proportional to the fragment size. c. Positively charged DNA migrates more rapidly than negatively charged DNA. d. Uncut DNA migrates farther than DNA cut with restriction enzymes. 24- Why do scientists load DNA of known sizes (also called "marker" or "ladder") into...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
You are using PCR to amplify a 300 bp target sequence, a portion of Gene X, from human genomic DNA isolated from patients' blood samples. The instructions for this procedure tell you to include Samples A and B, whose contents are listed below, with each batch of patient samples that you run. Ingredients Sample A Sample B 10x PCR Buffer (Tris,KCI,MgCl2,BSA) 5 mL 5 mL H2O 37.8mL 38.8mL dNTP's 3 mL 3 mL Taq DNA polymerase 0.2 mL 0.2 mL...
A student uses the same gel extraction and
quantification protocols used in Lab 5, with the following
exceptions:
Only half of the 50µL pMD2 plasmid digestion reaction
was loaded on the gel.
The student did a 1:25 dilution of the extracted
backbone during the quantification.
The student measures the same absorbance (0.015). Using
the protocol form the lab manual, what was the concentration (in
ng/µL) of the plasmid stock concentration before performing the
digestion reaction? (2pts)
Gel extraction Materials PE...