Restriction enzymes cut at a specific site in the DNA called the restriction site. They are palindromic sequences. Each enzyme has a specific restriction sites. Some cut leaving an unpaired sticky ends. Some cut with no sticky end. Such cuts are called blunt ends. Hae III produces blunt ends because it leaves no unpaired ends of the DNA.
Hae IIIrecognizes GGCC palindromic sequence and cuts between GG and CC on both strands.
Option B is the right one.
UGLIOLI 0. PLS You will be using the restriction enzyme Haelll to cut your DNA. What...
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
A restriction map lists the
locations of DNA sequences that are cut by a particular restriction
enzyme for a piece of DNA, such as a chromosome or a plasmid.
Restriction maps are important when generating a construct for
experimental use. Digesting the DNA sequence with the restriction
enzymes will result in fragmented DNA of predictable sizes, based
on the restriction map, that allow a researcher to analyze if his
or her construct was generated correctly when visualized using gel
electrophoresis....
If you cut the following single stranded DNA fragment with a restriction enzyme with restriction site of 5’GAATTC 3” and the cutting point between G and A. a. How many fragments you will get b. Specify the size (Number of bases) and the sequence of each fragment, pay attention to DNA direction (5’-3’) 5” ACATTGTCCGGGAATTC CGGGCTAGGCAT T GAATTGGAACA GAATTC GGGCCCGATCCGTA 3
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3' 3' CCGG 5 5' AAGCTT 3 3' TTCGAA 5 5' RGGWCCY 3 3' YCCWGGR 5 Cleavage 5G AATTC 3' 3' CTTAA G 5'...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
Need Part C answered only.
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W represents adenine or thymine. Enzyme EcoRI EcoRV Target sequence 5' GAATTC 3' 3' CTTAAG 5 5' GATATC 3 3' CTATAG 5 5' GGCC 3 3' CCGG 5 5' AAGCTT 3' 3' TTCGAA 5 5'RGGWCCY 3 3' YCCWGGR 5 Cleavage 5'G AATTC 3'...
please answer question numbe 2.
Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...
Restriction endonucleases are: [ can be more than one] Scientists received Nobel Prize in 1978 for discovering restriction endonucleases. Bacteria keeps their own DNA modified preventing digestion by their own enzyme. Enzymes found in bacteria that digests DNA. Each restriction enzyme recognizes a specific DNA sequence. Bacteria uses their own restriction enzymes for their defense against viral infection. Which of the following is/are correct for chemical synthesis of oligo DNA? answer can be more than one Any nucleotide is added...
24. What do restriction enzymes do? A Randomly cut DNA B. Produce protein C. Cut DNA at a specific nucleotide sequence D. Copy DNA 25. Which of the following is an example of a differentiated cell? A. Embryonic Stem Cell B. Hematopoeitic Stem Cell C. Adult Stem Cell D. Liver Cell 26. An example of a small, circular DNA molecule used as a vector to transfer foreign DNA to a host cell is a A. plasmid B prion C. liposome...