Question

You want to generate billions of copies of a DNA fragment (sequence) consisting of ONLY the bracketed sequence in the DNA molecule below. Even though in “real life” we use primers around 20 bases long, let’s suppose for this example that 3 base long primers will work successfully. Which of the following primers will work to generate your PCR amplicon (DNA fragment)?

5-AATGAGCCATC[CCATATAAGCCGCGAGTTTG CATGTAC---3 O 5CCA3 alone O 5CCA3 and 5CAA3 O 5TGG3 and 5TTG3 O SATC3 and 5

0 0
Add a comment Improve this question Transcribed image text
Answer #1

5'ATC3' AND 5'ATG3'

As we have to make 3 base long primer and we know that primer is made from bases adjacent to the bracketed sequence that's why we take 3 bases from both side of bracket sequence to make primer.

5'.....ATC[CCA..........TTG]CAT.....3'

3'.....GTA....5' --primer 1

Primer 2--- 5'...ATC...3'

3'.....TAG[GGT..........AAC]GTA....5'

Add a comment
Know the answer?
Add Answer to:
You want to generate billions of copies of a DNA fragment (sequence) consisting of ONLY the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select...

    The following diagram represents a replication bubble associated with DNA synthesis. Based on this diagram, select all of the options below that are true. 1 | 2 ---- Quadrants 1 and 4 are associated with lagging strand synthesis Quadrants 1 and 4 are associated with leading strand synthesis Quadrants 1 and 2 are associated with lagging strand synthesis Quadrants 3 and 4 are associated with lagging strand synthesis Synthesis of both daughter strands is completely continuous Telomerase activity is needed...

  • Suppose you have a PCR amplicon consisting of the sequence below. The primers used to generate...

    Suppose you have a PCR amplicon consisting of the sequence below. The primers used to generate the amplicon are: 5'AT3' and 5'GA3'. Which of the following is true? a. If you use the 5'AT3' primer for a subsequent sequencing reaction, the sequence of the shortest fragment containing a chain terminating nucleotide is: 5'ATC3' b. If you use the 5'AT3' primer for a subsequent sequencing reaction, the sequence of the shortest fragment containing a chain terminating nucleotide is: 3'TAG5' c. If...

  • You determine that you have only three copies left of an important DNA fragment, so you...

    You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (109) copies of the fragment? I know the answer is 29. I just don't understand how to get that answer.

  • pls help The DNA sequence below is 300 bases long. This is only one strand of...

    pls help The DNA sequence below is 300 bases long. This is only one strand of DNA going from 5' starting at base 1081 to 3' ending at base 1380. The complementary strand is NOT shown. The sequence is broken up into 10 base sections to make counting easier. Design primers to amplify a DNA fragment that is 150bps in length. 1081 cagtatcagg tggtggcccc ttgcccccag tcagcaccct gacatcactg cacagtctgt 1141 ctgcctcgcc tgctccccac catggactca toatgacctc cctgcccagc gtcatgagtc 1201 tgggagagtc ctctctcctc ataggtcaaa ccgtacctgt...

  • 1.) PCR a.) Using the dsDNA sequence 1 as a template, you want to generate dsDNA...

    1.) PCR a.) Using the dsDNA sequence 1 as a template, you want to generate dsDNA sequence 2 using PCR. What are the sequences of the two primers you use? 15nt of each primer have to anneal perfectly to the template. Write the primer sequences in 5’->3’ direction in the provided space. (25 points) Sequence 1 5-TATAGGACGATGTTGATGAATGGTACAATCACAGTACGTACGTACAGTCAGTGAAA-3 Sequence 2 5-TAGCGGTACATGTTGATGAATGGTACAATCACAGTACGTACGTACAGTCTATCGAT-3 Primer 1 5- -3 Primer 2 5- -3 1.) PCR a.) Using the dsDNA sequence 1 as a template, you...

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into...

    Suppose you want to sequence the following DNA segment: 5’-GATCTCTTGAAATG-primer site-3’ You clone the fragment into a plasmid, transform it into bacterial cells and isolate DNA from one of the bacterial colonies. You use the Sanger sequencing method to determine the sequence, separating the products from the sequencing reactions by gel electrophoresis. Draw the bands that should appear on the gel from the four sequencing reactions.

  • not sure what the correct answers are To be export-ready, an mRNA molecule must: have its...

    not sure what the correct answers are To be export-ready, an mRNA molecule must: have its 5' cap removed be bound by EJCS have its poly-A tail removed have at least half of its introns removed od 80e covou The extension temperature used during PCR is determined by: the length of the PCR product you want to generate the DNA polymerase that is being used the annealing temperature of your primers x the source of your template DNA (eg, genomic...

  • You want to amplify the DNA between the two stretches of sequence shown below. Of the...

    You want to amplify the DNA between the two stretches of sequence shown below. Of the listed primer pairs, choose the correct pair that will allow you to amplify the DNA by PCR. 5'-ACATTACCAA----GACCTGCTTT-3' 3' -TGTAATGGTT----CTGGACGAAA-5' 5' -TGTAATGGTT-3' and 5'-TTTCGTCCAG-3' O 5'-ACATTACCAA-3' and 5'-AAAGCAGGTC-3' 5'-TGTAATGGTT-3' and 5'-CTGGACGAAA-3' O 5'-AACCATTACA-3' and 5'-CTGGACGAAA-3'

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT