Question

1.) PCR

a.) Using the dsDNA sequence 1 as a template, you want to generate dsDNA sequence 2 using PCR. What

are the sequences of the two primers you use? 15nt of each primer have to anneal perfectly to the template.

Write the primer sequences in 5’->3’ direction in the provided space.

(25 points)

Sequence 1

5-TATAGGACGATGTTGATGAATGGTACAATCACAGTACGTACGTACAGTCAGTGAAA-3

Sequence 2

5-TAGCGGTACATGTTGATGAATGGTACAATCACAGTACGTACGTACAGTCTATCGAT-3

Primer 1 5-

-3

Primer 2 5-

-3

1.) PCR a.) Using the dsDNA sequence 1 as a template, you want to generate dsDNA sequence 2 using PCR. What are the sequences

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Guanive Ca) es Coupin TALGATOT RAe.inte ar Cpimer 1) ance-2 mer-2 e wih G with c

Add a comment
Know the answer?
Add Answer to:
1.) PCR a.) Using the dsDNA sequence 1 as a template, you want to generate dsDNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want...

    4. (1.5 pts)You are practicing designing primers that you can use in PCR reactions. You want your primers to allow you to amplify the sequence found below. 5°-АсттсслтАTстсТАЛААТАССАТCGATСтстсссссстАGстAСCТААССАGAGACCСТАССG-3. 3-тслАсстатАсAGATTTTATсстасстаGлCAссссССATCCATCGAтTСстстстасGAТСCС-5. Markers part (a) part (b) part ck Right primer should anneal to this region Left primer should 87 nts anneal to this region 80 nts 70 nts 60 nts 50 nts 40 nts 27 nts Draw into the following gel lanes what size(s) of PCR products you would get if you...

  • Suppose you have a PCR amplicon consisting of the sequence below. The primers used to generate...

    Suppose you have a PCR amplicon consisting of the sequence below. The primers used to generate the amplicon are: 5'AT3' and 5'GA3'. Which of the following is true? a. If you use the 5'AT3' primer for a subsequent sequencing reaction, the sequence of the shortest fragment containing a chain terminating nucleotide is: 5'ATC3' b. If you use the 5'AT3' primer for a subsequent sequencing reaction, the sequence of the shortest fragment containing a chain terminating nucleotide is: 3'TAG5' c. If...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • help with the whole question 9 please. 9. a) You are tasked with amplifying a fragment...

    help with the whole question 9 please. 9. a) You are tasked with amplifying a fragment of interest from a sample of genomic DNA by using PCR List the components that need to be included in any standard PCR, give the function of each. A PCR is typically performed in an automated thermo cycling machine. Give the three steps required in each cycle, and explain the function of each. The figure below represents a step during the first PCR cycle....

  • You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...

    You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...

  • To do the PCR, we used 2 universal primers that roughly match sequences near the 5’...

    To do the PCR, we used 2 universal primers that roughly match sequences near the 5’ and 3’ ends of the 16S rRNA gene. The forward primer binds near the 5’ end to the complementary strand of the sequences shown below. The sequence of the forward primer is: Agagtttgatcctggctcag The reverse primer binds near the 3’ end to the sequences shown below. The sequence of the reverse primer is: ACGGCTACCTTGTTACGACTTG To find the primer in the sequence below, you must...

  • You want to use PCR to amplify the entire DNA shown in the figure below. Of...

    You want to use PCR to amplify the entire DNA shown in the figure below. Of the listed primers, choose the pair that will allow you to amplify this stretch of DNA by PCR. (9 points total) DNA to be amplified 5’-CGATTCGAGCCATTCGAACTCGATCAGCCGATTCGATCAACCTTGGACAGTCAG-3’ 3’-GCTAAGCTCGGTAAGCTTGAGCTAGTCGGCTAAGCTAGTTGGAACCTGTCAGTC-5’ Primers: (1) 5’-GCTAAGCTCGGTA-3’ (5) 5’-CTTGGACAGTCAG-3’ (2) 5’-GAACCTGTCAGTC-3’ (6) 5’-CGATTCGAGCCAT-3’ (3) 5’-CTGACTGTCCAAG-3’ (7) 5’-ATGGCTCGAATCG-3’ (4) 5’-GACTGACAGGTTC-3’ (8) 5’-TACCGAGCTTAGC-3’ Answer: I will need primer number _____ and primer number _____

  • You want to generate billions of copies of a DNA fragment (sequence) consisting of ONLY the...

    You want to generate billions of copies of a DNA fragment (sequence) consisting of ONLY the bracketed sequence in the DNA molecule below. Even though in “real life” we use primers around 20 bases long, let’s suppose for this example that 3 base long primers will work successfully. Which of the following primers will work to generate your PCR amplicon (DNA fragment)? 5'-AATGAGCCATC[CCATATAAGCCGCGAGTTTG CATGTAC---3' O 5'CCA3' alone O 5'CCA3' and 5'CAA3' O 5'TGG3' and 5'TTG3' O S'ATC3' and 5'TAC3' O...

  • Animal Science Cell and Molecular Biology Quesiton -- The bolded sequence in the sequence in question...

    Animal Science Cell and Molecular Biology Quesiton -- The bolded sequence in the sequence in question 5 is a variable number tandem repeat sequence (VNTR or STR). The following table shows the PCR product lengths amplified using the primers you designed in question 5 and DNA samples from four sets of skeletal remains found buried in an archaeological excavation. List the VNTR lengths for the two alleles for each skeleton in the table below. 5. Design 15 nucleotide long PCR...

  • rate for answering questions compeletly. You plan to use a PCR based assay to determine whether...

    rate for answering questions compeletly. You plan to use a PCR based assay to determine whether 3 mosquitoes that you have collected are infected with West Nile virus. You have available to you three different virus-specific primers. The primers recognize sequences at the following nucleotide positions on the viral genome: primer 1: 155-176 primer 2: 745-720 primer 3: 926-905 The 5' and 3' ends of the genome are indicated on the long line The first nucleotide at the 5' end...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT