Question

2. Design a primer pair (5 nucleotides each) to amplify only exon 2 of the gene model below. Use the primer pair you designed

0 0
Add a comment Improve this question Transcribed image text
Answer #1

In order to design the primer pair for amplifying exon 2 of the given gene model, we will first draw the complementary sequence to that given to make it double stranded. Further, since we only want to amplify exon 2, we will consider only that sequence and design the forward and reverse primers for it.

Here is how it can be done.

The given sequence is:

5'-CTCGAAGCTCTAGACGCTCTC-3'

3'-GAGCTTCGAGATCTGCGAGAG-5' (complementary strand)

The forward primer will be on the complementary strand in 5'-3' direction.

3'-GAGCTTCGAGATCTGCGAGAG-5'

5'-CTCGA-3' (Forward primer)

The reverse primer will be on the template strand in 5'-3' direction.

5'-CTCGAAGCTCTAGACGCTCTC-3'

  3'-GAGAG-5' (Reverse Primer)

This reverse primer will be written in 5'-3' direction i.e. 5'-GAGAG-3'

Thus the primer pair for the amplification of exon 2 is :

5'-CTCGA-3' (Forward primer)

5'-GAGAG-3' (Reverse Primer)

Add a comment
Know the answer?
Add Answer to:
2. Design a primer pair (5 nucleotides each) to amplify only exon 2 of the gene...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 1. Create the primers to amplify the gene of interest. 1. Below is almost the full...

    1. Create the primers to amplify the gene of interest. 1. Below is almost the full sequence of the coding strand of the F9 gene (exon 2-exon4) that you found in the online database (NCBI, Genomic sequence F9 gene). Some of the sequence is missing, but you know how many nucleotides are skipped. Design forward and reverse primers 18nt each for PCR that will isolate EXACTLY the sequence that is in bold typeface. Exon 2 = 164 nt Intron 2...

  • You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to...

    You are given the following double-stranded DNA template (only top strand shown). Design a primer-pair to amplify all of the red (ds) sequence, and only the red sequence? Primers should be 8 nts long (note: usually 17-25 nts long) Hint: Think about direction of DNA synthesis and annealing of primer to double-stranded template ! To answer, write the primer sequence (8 nts each) into the provided space below with the indicated 5' 3' polarity. 5'---AATGCCGTCAGCCGATCTGCCTCGAGTCAATC GATGCTGGTAACTTGGGGTATAAAGCTTACCCATGG TATCGTAGTTAGATTGATTGTTAGGTTCTTAGGTTTA GGTTTCTGGTATTGGTTTAGGGTCTTTGATGCTATTA ATTGTTTGGTTTTGATTTGGTCTTTATATGGTTTATG TTTTAAGCCGGGTTTTGTCTGGGATGGTTCGTCTGAT...

  • "You wish to amplify the region of DNA between the bolded nucleotides below. Determine the REVERSE...

    "You wish to amplify the region of DNA between the bolded nucleotides below. Determine the REVERSE primer that you will use for PCR. Write the primer sequence 5` to 3` with no spaces. Make the primer 10 nucleotides long. 5` AGTCA CGATG TTCGC TAGAT AGCTC GATAT ATTTG CCGAT CGCCT 3`

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • may you explain and show work if possible. thank you. 21. Which primer pair would amplify...

    may you explain and show work if possible. thank you. 21. Which primer pair would amplify the genomic DNA below? 5'-TTGGGCAATAATGTAGCGCCTT... GGCTAAGATCTGAATTTCCGAG-3' a. 5'-TTGGGCAATAATGTAGC-3" 5-GATCTGAATTTCCGAG-3' 5'-TTGGGCAATAATGTAGC-3 5-GAGCCTTTAAGTCTAGA-3' 5- TTGGGCAATAATGTAGC-3' 5'-CTCGGAAATTCAGATCT-3' 5'-AACCCGTTATTACATCG-3' 5'-CTCGGAAATTCAGATCT-3' 5-AACCCGTTATTACATCG-3' 5-CTAGACTTAAAGGCTC-3'

  • The Psilotum nudum genome is 2.5 x 1011 bp. You wish to design a primer to...

    The Psilotum nudum genome is 2.5 x 1011 bp. You wish to design a primer to amplify a specific gene in the genome. - Part A In general, what length of oligonucleotide would be sufficient to amplify a single unique sequence? To simplify your calculation, assume that all bases occur with an equal frequency. Hint: The frequency of occurrence of a PCR primer in genomic DNA is given by this equation: genomic DNA length x sequence frequency The sequency frequency...

  • You want to use PCR to amplify the entire DNA shown in the figure below. Of...

    You want to use PCR to amplify the entire DNA shown in the figure below. Of the listed primers, choose the pair that will allow you to amplify this stretch of DNA by PCR. (9 points total) DNA to be amplified 5’-CGATTCGAGCCATTCGAACTCGATCAGCCGATTCGATCAACCTTGGACAGTCAG-3’ 3’-GCTAAGCTCGGTAAGCTTGAGCTAGTCGGCTAAGCTAGTTGGAACCTGTCAGTC-5’ Primers: (1) 5’-GCTAAGCTCGGTA-3’ (5) 5’-CTTGGACAGTCAG-3’ (2) 5’-GAACCTGTCAGTC-3’ (6) 5’-CGATTCGAGCCAT-3’ (3) 5’-CTGACTGTCCAAG-3’ (7) 5’-ATGGCTCGAATCG-3’ (4) 5’-GACTGACAGGTTC-3’ (8) 5’-TACCGAGCTTAGC-3’ Answer: I will need primer number _____ and primer number _____

  • need help with this Tm: Tm: 16. You wish to amplify the DNA fragments below and...

    need help with this Tm: Tm: 16. You wish to amplify the DNA fragments below and add cut sites for subsequent cloning. Design both primers with the restriction enzymes cut sites listed, and add two overhang bases to each primer. Label the extra bases and cut sites. Each primer should be 14 nucleotides in length. a. 5'-CTATGAGGTCCTGCGTTAGTGTTACC-3' Forward: 5'- 5' EcoRI, 3' BamHI, overhang bases Reverse: 5'- Annealing Temperature: b. 5'- CCTGGGTGTTACATGCCATTAGCGTT-3' Forward: 5'- Tm: 5' HindiII, 3' Sphl, overhang...

  • based on the PCR results, estimate how mang CTG repeats are present in rhe DMPK gene...

    based on the PCR results, estimate how mang CTG repeats are present in rhe DMPK gene of parient 1: part b: why are there 2 different sized bands detected in patient 2? a onown below is DNA sequence from the 3'UTR of the DMPK gene, where the bold (CTG) is repeated 20 times in healthy patients and 50-1,500 times in patients with Myotonic Dystrophy. Using single letter abbreviations, write the first 3 nucleotides of both primers you would need to...

  • 2. Design a PCR experiment to amplify a sequence of interest. Use the following reagent concentrations...

    2. Design a PCR experiment to amplify a sequence of interest. Use the following reagent concentrations for calculating your cocktail. Fill in the chart below. A. Fill in the chart below with the volumes that would be added to each tube. Note the final volume of the reaction. Show your calculations for full credit. REAGENT Final Concentration (50 ul Reaction) 1x Test Reaction (+) Control Reaction 10x Reaction Buffer ML dNTPs (15 mm) 200 UM 0.2 UM ul 0.2 um...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT