Question

The sequence of the nucleotide chain contained in the circled band of the image below is:

TOP ddCTP ddATP ddTTP ddGTP : BOTTOM:

a) 5'-primer-GC-3'

b) 5'-primer-CG-3'

c) 5'-primer-CTGAG-3'

d) 5'-primer-GACTC-3'

0 0
Add a comment Improve this question Transcribed image text
Answer #1

the results of the Sanger sequencing is shown in the image.

DNA polymerase adds new nucleotides to the 3` OH of the existing nucleic acid, In Sanger sequencing, 4 PCR reactions are used and each of the reactions contains any one of the ddNTP, ddNTP lack 3`-OH once the ddNTP is incorporated the PCR stops there. if the first nucleotide from the primer is G, when ddGTP is added small band is obtained and the size of the bands increases as the distance from the primer increases the sequence from the primer till the circled band is

GACTC so the answer is

d) 5'-primer-GACTC-3'

Add a comment
Know the answer?
Add Answer to:
The sequence of the nucleotide chain contained in the circled band of the image below is:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The “TOP” of the gel depicted below is where the 4 separate reactions were loaded for...

    The “TOP” of the gel depicted below is where the 4 separate reactions were loaded for sequence determination. Which of the following is true regarding the image below? a. The largest/longest nucleotide chains are at the top of the image b. The largest/longest nucleotide chains are at the bottom of the image c. A negatively charged electrode will be placed at the “BOTTOM” to run the DNA through the ge d. The 5’ end of each DNA chain contains a...

  • 1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A,...

    1) You have four tubes with buffer, primer, DNA polymerase, template, and dNTP’s. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template...

  • Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts)...

    Fall 2017 CHE 380: Introduction to Biotechnology Exam3 (I hr 20 min) Question 3 (28 polnts) and label the reaction was conducted on the b. Read the sequence A DNA sequencing was template strand in a thin capillary gel tube containing primers, DNA polymerase, deox yribuneeleotides and|メイenmcaT luorescently tagged dideoxyribunecleotides and a e. The smallest fragment is computer was used to record the fluorescent peaks during fluorescently tagged with (A)ddATP (B) ddGTP (C) ddCTP (D) ddTTP was used to reoribunecleotidesnanTCAATGaTa...

  • 3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix...

    3. Now, you repeat the procedure of question 2, but you add a complete dNTP mix (containing ATP, CTP, dGTP, and dTTP), and ddGTP. In this way, when the DNA polymerase incorporates a nucleotide carrying guanine into the growing DNA strand, it will use sometimes dGTP and sometimes ddGTP. When ddGTP is used, the DNApol will no longer add nucleotides to the DNA strand. For ala3, write below three the possible molecules produced. For b1-b3, consider that you used ddATP...

  • Suppose you have a PCR amplicon consisting of the sequence below. The primers used to generate...

    Suppose you have a PCR amplicon consisting of the sequence below. The primers used to generate the amplicon are: 5'AT3' and 5'GA3'. Which of the following is true? a. If you use the 5'AT3' primer for a subsequent sequencing reaction, the sequence of the shortest fragment containing a chain terminating nucleotide is: 5'ATC3' b. If you use the 5'AT3' primer for a subsequent sequencing reaction, the sequence of the shortest fragment containing a chain terminating nucleotide is: 3'TAG5' c. If...

  • At a specific area of a chromosome, the sequence of nucleotides below is present where the...

    At a specific area of a chromosome, the sequence of nucleotides below is present where the chain opened to form a replication fork: 3' C C T A G G C T G C A A T C C 5' A 7-nucleotide RNA primer is formed starting at the underlined T (T) of the template. What is the primer sequence, including 5' and 3' end? The "T" in bold is the underlined T.

  • 5) The following sequence of bases is present along one chain of a DNA double-helix that...

    5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...

  • NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...

    NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...

  • The following primer sequence was used in a Sanger sequencing reaction along with the following template,...

    The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer:            5’ TGGCGCGC 3’ Template:       5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2

  • QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template")....

    QUESTION 31 The gel below shows the result of sequencing a piece of DNA (the "template"). Each lane shows the fragments of the new strand (the "daughter" strand) that are produced when a given ddNTP is added to the PCR reaction. Based on these results, what is the sequence of the template (original) DNA strand? Please write (type) it out, making sure you indicate the 5' and 3" ends ddATP ddTTP ddCTP ddGTP well well well well save Click Save...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT