Template 5' 3' end in red colour , forward primer binding site
in orange colour , reverse primer binding site in green colour

c)
size of PCR product is 159 bp
NEED HELP!! I am a little lost DNA Template Used in Forensic Identification: TATTGTACGG TACCATAAAT ACTTGACCAC...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
please help if you can
3. You cloned a 20 kb piece of DNA, which contains restriction sites as shown below. 281534 5 B 4 & 5 B = BamHl site, E = EcoRI site, H = Hindill site Numbers above the segments represent the sizes of the regions in kb. Draw and label (in the agarose gel below) the sizes of the fragments you would expect to see after complete digestion of this piece of DNA with the following...
A plasmid used as a cloning vector in E. coli must have… Does sequence similarity between genes play an important role in assigning gene function? Successful insertion of a DNA fragment into the multi-cloning region (restriction sites) of a recombinant plasmid is detected by what changes? Understand the concept of (restriction enzyme produced) DNA fragment separation by gel electrophoresis. In addition to restriction enzymes, which enzyme(s) are required to insert a fragment of DNA into a cloning vector? What is...
I just need the answers to questions 2 and 3. My DNA ladder is
in lane 2 with the yellow arrow pointing to it. Thanks!
Part 2: Gel purification and ration Gel Slice and PCR Product Preparation modified from IBSci.com instructions for gel and PCR clean-up system A. Dissolving the Gel Slice 1. Following electrophoresis, excise DNA band from gel and place gel slice in a 1.5ml microcentrifuge tube. 1b. Use an analytical balance to weigh gel slice. Record weight...
This is for an a 3 unknown I am doing in Microbiology. And I don't quite understand it, if you could please help thanks A. How did you prepare the template DNA? B. Name the gene that we will be sequencing in order to identify the unknown. C. Explain why this region is considered to be the target for identification instead of sequencing the entire genome? D. What is the size (in bp) of target DNA in E. coli? B....
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
please answer question numbe 2.
Restriction endonucleases are bacterial enzymes that recognize, bind, and cut DNA strands at specific recognition sequences. They evolved to protect bacteria from bacterial viruses and are very useful for a wide variety of molecular biology applications. Some of the more common ones include EcoRI which recognizes the 6 bp sequence 5 'GAATTC 3' and cleaves the phosphodiester backbone after the G. Hind III_(AAGCTT), BamHI (G|GATCC), Pstl (CTGCAG), Not! (GC|GGCCGC), Ndel (CATATG) Kpnl (GGTAC^C), Bgl II...
I
need the answers for questions 2 and 3. My DNA ladder is in lane 2
marked by the yellow arrow. Thanks!
Here is the only other info I have. Thanks!
Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...
En (2 points) You isolated your mitochondrial DNA in Part I. In step 6, you discard the supernatant, but keep the pellet. In step 15, you discard the pellet, but keep the supernatant. Explain why the pattern is different between the two steps and the consequence of mixing up these two steps. Procedure Part 1: mt DNA Isolation from your cheek cells. Lysis solution is used to breakdown the cells in this step, you will isolate MEONA from cheek cells....
Molecular Key Calculation - PLEASE NEED
HELP TO CALCULATE IT!
You are setting up you own Master Mix for doing a Not1
restriction digest.
In each digestion tube you will be adding 10 ul DNA and 40 ul of
your Master mix.
You are given 10 x Not1 buffer, 10 ug/ul acetylated BSA, Not1
restiction enzyme 10 units/ul and sterile water.
How much of each of the 4 reagents would you use to make 500 ul of...