How could an early stop mutation lead to an N-terminal truncated
protein? What experiments would you conduct to confirm this
hypothesis? (This is in regard to an article on BRCA 1 mutations,
but this question is in general)
N-terminal truncation occurs due to the changes in the structural gene by a premature stop codon (by a frameshift or non-sense mutation) that terminates the elongation of the specific gene. In the case of early stop mutation or non-sense mutation may interfere with the translation, and might terminate it. But the reinitiation ribosomes can occur downstream of the start codon, AUG. If the stop codon was proximal to the start codon, the reinitiation efficiency is normally high, and this leads to the expression of the N-truncated protein. Though reinitiation occurs, the rate of reinitiation is lower than the original rate of initiation. Leaky scanning is associated with the expression of the N-truncated protein post the stop codon.
Western blotting, real-time quantitative PCR (RT- qPCR), and RNA interference studies can help in analyzing the expression of the N-terminal truncated protein.
(i) Western blot studies using the antibody binding can show the variants of the N-truncated protein. the N-truncation is dependent on the loci on the non-sense mutation to the start codon. Following the stop codon, the ribosomes can scan an AUG and can reinitiate an N-truncated protein, which can be observed by the protein variants in the Western blotting.
(ii) The RNA that has been isolated can be converted to cDNA using the reverse transcription, and the RT- qPCR can be performed for analyzing the variants. The ratio between the normal expression and truncated expression can be analyzed to know about the promoter variation, level of truncated translation, etc.
(iii) Cell line studies for N-truncated proteins can be transfected with specific siRNA directed against the mRNAs that get transcribed.
Ref: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6614817/
How could an early stop mutation lead to an N-terminal truncated protein? What experiments would you...
QUESTION 36 Ferritin is an intracellular protein that stores essential iron and releases it in a controlled fashion when needed. Hereditary hyperferritinaemia-cataract syndrome (HHCS) is a relatively rare disorder with an autosomal dominant trait. The disease is characterized by increased L-ferritin in serum and tissues and early onset of bilateral cataracts. Iron metabolism is normal, and there is no tissue iron overload. HHCS can be caused by mutations in the 5' non-coding region of the ferritin gene. Which of the...
2. You are studying a (hypothetical) newly-described member of a family of protein kinases (XYK6), which you suspect may function as an oncogene, based upon the observation that specific point mutations (especially Thr489Asp) are sometimes seen in human breast tumors. You’ve queried the TCGA database and found that this mutation, when present, seems to be an “early” mutation, since it is seen as frequently in early-stage lesions as in later-stage tumors. You therefore hypothesize that it may be a driver...
Explain what classifies a mutation as “temperature‑sensitive” by comparing phenotype(s) with a wildtype allele. How is this type of phenotype explained by protein behaviour? Would the following types of mutations most likely have: severe effects, mild effects, or no effect on protein function? Briefly explain your answers. Note that there may be more than one correct answer, but you need only to give one sensible answer and explain your reasoning. [6 marks] A nonsense mutation occurring in sequences encoding amino...
1. How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron micrograph of polyribosomes from such a mutant differ from the normal pattern? 2. Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. What are the three excision-repair systems found in eukaryotes, and which one is responsible for correcting thymine-thymine dimers that form as a result of UV light damage to DNA? 3. What is the name given to...
last
part last part of question says: explain why this type of mutation
is your selected protein or protein complex would fix your initial
defect
3. (8 points) You observe a population are missing their DNA chromosome after di occurred to eliminate the function of an import packaging or localizing partitioning of the cell in two ve a population of dividing cells and discover that many of these cells some after division! You suspect that a mutation has mate the...
In-Class Activity #12, Protein Tratlicking Worksheet 1. You are interested in four different proteins in a yeast cell: • protein 1 is a cytosolic protein protein 2 is a secreted protein • protein 3 is a nuclear protein protein 4 is a cell surface membrane protein with N-terminal end in extra-cellular space. a. You plan to study how the proteins are localized to their specific destination by creating the following mutations in the genes encoding proteins 1-4. Indicate how the...
Please provide justifications for all answers so I
understand. Extra detail is very helpful. Thank you so
much.
Question 1 [7pts] A. The following DNA sequence contains an open reading frame that codes for an 8 amino acid protein. Which open reading frame (1, 2 or 3) would need to be translated to yield that protein? (1pt) TAATGTATATCCCACGGTATGGAGTTTAAG B. In the frame you chose, give an example of a silent mutation at the third amino acid. (2pt) C. Now give...
QUESTION 13
Which of the following would occur if a mutation caused Kinase 1
to be unable to be phosphorylated? (Select all)
RTK would bind VEGF
RTK would phosphorylate itself
RAS would become active
The phosphorylation cascade would occur
The endothelial cell would divide
0.2 points
QUESTION 14
Imagine that an endothelial cell has a mutation in several of
the enzymes that perform mismatch repair. The endothelial cell
replicates its DNA and then divides into two cells. The resulting...
Match the following phenotypes with the mutation that would be the most likely to be its cause. The mutant proteins are listed below, followed by the protein domain that is mutated in each case, followed by the amino acid change that is a result of the mutation Try to answer each question by using the following reasoning: if you observe a phenotype, then that could be due to a mutation in protein in which the domain has had an amino...