Question

1. Describe the composition and function of cytoskeleton. 2. Define organelle. Write down the functions of each organelles of
0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. The cytoskeleton functions to provide support in a cell. It is a network of protein fibers that supports cell shape and anchors organelles within the cell.

There are three main structural components of the cytoskeleton. They are microtubules (formed by tubulin proteins), microfilaments (formed by actins) and intermediate filaments. All three components interact with each other non-covalently.

2. An organelle is nothing but a tiny cellular structure that is responsible for performing specific functions within a cell. In an animal cell, there are a lot of organelles namely:

nucleus: Holds DNA, ribosome: make proteins, Golgi apparatus: packaging of macro molecules for transport elsewhere in the cell, cytoskeleton: helps to maintain cell shape, smooth endoplasmic reticulum: carries materials through cell, mitochondria: break down food to make ATP, lysosome: breaks down larger food molecules into smaller molecules, and others

Please post separate questions one by one. Can't answer all in a single question.

Add a comment
Know the answer?
Add Answer to:
1. Describe the composition and function of cytoskeleton. 2. Define organelle. Write down the functions of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • where does transcription begin 3. List the major types of RNA and include what they code...

    where does transcription begin 3. List the major types of RNA and include what they code for, their function in the cell and which type is translated. 4. If a bacterial protein has 2,500 amino acids long, how many nucleotide pairs long is the ger sequence that codes for it? 5. Where does transcription begin? 6. What is the template and nontemplate strands of DNA? 7. Why is only one strand transcribed, and is the same strand of DNA always...

  • 1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes...

    1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes that are involved for each. 2. Describe three ways in which transcription in in eukaryotes is different from that of prokaryotes. 3. At what stage of transcription do these alterations take place in? Initiation, Elongation or Termination? 4. Draw a prokaryotic gene with the following features: a. A promoter region with -35 and -10 consensus sequences. b. The start point of transcription with first...

  • 1. Describe one experiment that can test the hypothesis that DNA replication is semi conservative. Describe...

    1. Describe one experiment that can test the hypothesis that DNA replication is semi conservative. Describe the results of this experiment if replication was conservative. And if it was distributive? 2. What type of chemical bond contributes to the specificity of base paring in the DNA? Are there any other chemical or physical factors in the structure o f the DNA molecule contributing to the thermodynamic stability of the DNA? 3. List the m ajor differences between DNA and RNA....

  • 2) On your first day working in my lab, you obtain the following DNA sequence: 3'...

    2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...

  • all & Which of the following changes is a permanent mutation that can be passed down...

    all & Which of the following changes is a permanent mutation that can be passed down to the next generate A) a change in the DNA sequence B) a change in the mRNA sequence C) a change in the protein sequence D) all of these changes can be passed down to the next generation Cell. Chromosomes, & Cell Division 9. The following items are listed from the lowest to the highest level of organization: Atom; Molecule: Coll. What goes in...

  • 1)         Discuss the importance of magnification and resolution in microscopy. How are the magnification and resolution...

    1)         Discuss the importance of magnification and resolution in microscopy. How are the magnification and resolution of a light microscope different from that of an electron microscope? 2)         Which microscope would you use to study the following?             a) the changes in shape of a living human white blood cell             b) the finest details of the surface texture of a human hair             c) the detailed structure of an organelle in a liver cell 3)    State the cell theory?...

  • Hello! I am working on this genetics problem and was wondering if these two answers would...

    Hello! I am working on this genetics problem and was wondering if these two answers would make sense. Thank you for the help! Question 1 (1 point) Saved Why can bacteria have poly-cistronic genes? Because they need multiple cistron organelles so they segregate evenly during cell division. Because they have many exons that are joined together before translation Because ribosomes can be loaded at multiple Shine Delgano/AUG sequences. Because ribosomes are loaded at the single CAP site. Because the stability...

  • Please answer all questions. Oftentimes, unsaturated fatty acids are found in a fluid state at room...

    Please answer all questions. Oftentimes, unsaturated fatty acids are found in a fluid state at room temperature (e.g., olive oil). This is because unsaturated fatty acids contain a large number of ___________________. a. Hydrogen bonds b. Carbon-Carbon single bonds c. Carbon-Carbon double bonds d. Sulfide bonds e. Radioactive bonds Which of the following stages of aerobic cellular respiration generates the most ATP? a. Glycolysis b. Pyruvate breakdown c. Citric Acid Cycle (aka. Krebs Cycle) d. Oxidative phosphorylation e. Calvin Cycle...

  • What are the three functional groups that comprise a nucleotide? What do nucleotides have in common...

    What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...

  • 1. Which of the following statements about the flow of genetic information is true? a. Proteins...

    1. Which of the following statements about the flow of genetic information is true? a. Proteins encode information that is used to produce other proteins of the same amino acid sequence. b. RNA encodes information that is translated into DNA, and DNA encodes information that is translated into proteins. c. Proteins encode information that can be translated into RNA, and RNA encodes information that can be transcribed into DNA. d. DNA encodes information that is translated into RNA, and RNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT