Question

The promoter sequence of DNA is located: A.) behind the initiator codon. B.) ahead of the...

The promoter sequence of DNA is located:

A.) behind the initiator codon.

B.) ahead of the initiator codon.

C.) immediately ahead of the gene.

D.) behind the gene.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The promotor sequence is generally followed by the initiator codon, which marks the beginning of transcription. Hence it can be said that the promotor sequence of DNA is located ahead of initiator codon.

Add a comment
Know the answer?
Add Answer to:
The promoter sequence of DNA is located: A.) behind the initiator codon. B.) ahead of the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You hypothesize that a DNA sequence located 3.0 kb upstream of the promoter of a gene...

    You hypothesize that a DNA sequence located 3.0 kb upstream of the promoter of a gene you are studying contains an enhancer. To test your hypothesis, you use recombinant DNA techniques to insert a DNA fragment containing this DNA sequence into a plasmid also containing a “reporter gene.” Note:A reporter gene encodes for a protein that you can detect when expressed. For example, you could use the lacZ gene that encodes for the enzyme β-Galactosidase as a reporter gene. As...

  • 11. Using the DNA sequence below and the codon table on the projector, perform the following:...

    11. Using the DNA sequence below and the codon table on the projector, perform the following: a. Produce the correct MRNA transcript. On the DNA sequence below, the top strand is the template strand, and transcription begins immediately following the promoter sequence and ends at the end of the DNA sequence. (5 points) b. Produce the correct polypeptide sequence. (5 points) Prometer GTCACGGGTACCCTGTGTTAAGGCATCGTATGATACATACCACTATGTACCATGGACACAATTCCGTAGCATAAGCATGACCC CAGTGCCCATGGGACACAATTCCGTAGCATACTATGTATGGTGATACATGGTACCTGTGTTAAGGCATCGTATTCGTACTGGG 11. Using the DNA sequence below and the codon table on the projector, perform the following:...

  • A protein binds a DNA sequence downstream of a promoter. This results in an increased rate...

    A protein binds a DNA sequence downstream of a promoter. This results in an increased rate of transcription of the gene. Which of the following site is likely to be attached? a. Operon b. Terminator c. Activator binding site d. Promotor The following are produced by algae To prepare the insert for the gene cloning, you need to find a proper source of the DNA fragment. PCR is one of the most common ways to get the gene that you...

  • 25. Promoter 26. Replication 27. RNA Polymerase F. Sequence of DNA that controls gene express G....

    25. Promoter 26. Replication 27. RNA Polymerase F. Sequence of DNA that controls gene express G. binds an operator and stops gene expression in LAC operon by preventing RNA polymerase from binding gene and transcribing. H. Duplication of DNA in S phase of Interphase 28. Codon 29. Transgenic 30. Recombinant DNA 31. PCR 32. 33. 34. 35. 36. 37. 38. Plasmid Gene Therapy Gel electrophoresis DNA Profile DNA ligase GMO concern GMO benefit A. Analyzing STR patterns of blood or...

  • match 1. Cilia 2. Promoter 3. Flagellum 4. Microtubules 5. Codon 6. Termination signal 7. RNA...

    match 1. Cilia 2. Promoter 3. Flagellum 4. Microtubules 5. Codon 6. Termination signal 7. RNA polymerase 8. Anticodon 9. Transcription factor 10. Centrioles A. A special base sequence on DNA which signals the end of transcription B. A three-base sequence or triplet on mRNA that provides the genetic information used in protein synthesis C. Long projections formed by the centrioles D. The enzyme in protein synthesis that breaks E. Start point of a gene being transcribed F. Short, cell...

  • 1) Using the bacterial DNA sequence that the instructor gave you:

    1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...

  • The lightly stained region of DNA called: a. Heterochromatin b. Euchromatin c. Gene d. Exon ------------...

    The lightly stained region of DNA called: a. Heterochromatin b. Euchromatin c. Gene d. Exon ------------ Genes are coded massages written into enormously long molecules called: a. DNA b. RNA c. Polypeptide d. Polysaccharides -------------- Within DNA of human cell, only 75% represent codon. The function of the remainder are unknown. a. True b. False ---------- Function protein of genes sequences code for protein: a. Code b. Codon c. Exon d. Intron ---------- The 3 end of strand signified by...

  • 2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...

    2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...

  • The sequence below represents the first section of the template strand of DNA of a structural...

    The sequence below represents the first section of the template strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written 3 GTAACTĀTAATTACGCGTATAATGAT 5 What would be the nucleotides that form the promoter? What would be the 5'UTR sequence? What would be the sequence...

  • This double-stranded DNA represent a typical prokaryotic promoter containing both binding sites for sigma factor 70....

    This double-stranded DNA represent a typical prokaryotic promoter containing both binding sites for sigma factor 70. The start codon, ATG, is shown at the end of the promoter. Determine the sequence of the transcribed product from this promoter (up until and including the start codon). 5' CATGCTATAATGCTGTATTGAGATTATATTGACACTCAATAGGTTGTCAAGTGATG 3' 3' GTACGATATTACGACATAACTCTAATATAACTGTGAGTTATTCAACAGTTCACTAC 5

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT