Homework Answers
a. Target gene sequence
the template for the PCR technique is template DNA , i.e. DNA containing the gene sequence that is to be copied.
PCR is a technique used to produce multiple copies of a DNA strand. The components of this reaction include template, primer, DNA polymerase and free nucleotides. In this method the DNA template is added to a tube containing primers, nucleotides and DNA polymerase. This is processed through various temperatures and the DNA polymerase enzyme synthesise the copies of template starts from primers. The new strands act as template for the next cycle of PCR.
PCR method is mainly used for clonning, forensic testing of DNA and for disease diagnosis.
Add Answer to:
*Microbiology. Please answer the below question. The current
selected answer is incorrect. Thank you!
Incorrect 0/1...
*Microbiology. Please answer the below two multiple choice questions. The current selected answers are incorrect. Thank...
*Microbiology. Please answer the below two multiple choice
questions. The current selected answers are incorrect. Thank you,
will provide positive feedback for correct answers!
Incorrect Question 3 0/1 pts The replication fork has both leading (continuous) and lagging (discontinuous) synthesis because: a. The origin of replication only allows DNA synthesis to occur in one direction around the chromosome. b. Primase only works on the leading strand c. Helicase is slow in unwinding the double helix so the polymerization moving toward...
please answer this question with a correct and concise explanation, thank you so much! 1 QUESTION...
please answer this question
with a correct and concise explanation, thank you so much!
1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs
Please help me with these questions. Thank u very much. Q1: A DNA sample from an...
Please help me with these questions. Thank u very much. Q1: A DNA sample from an individual is analyzed. The population frequency of one of the STR alleles is 1 in 50, a second STR allele is 1 in 100, and a third STR allele is 1 in 30. What is the combined frequency of these three STR alleles? a.1 in 150,000 b.1 in 15,000 c.1 in 1,500 d.1 in 180 e.1 in 50 Q2: Which of the following hybridize...
Explain why its the answer 1. Which amino acid sequence would most likely be for the...
Explain why its the answer 1. Which amino acid sequence would most likely be for the transmembrane domain of a plasma membrane protein a) SKDTRENHQY b) KRHGPRKHRK C) DEWFDEESDT D)SFNQYCGQCN E) GAVMVAIGIL 36. What is the typical progression of steps in PCR reaction a) annealing of forward and reverse primers, denaturation of a DNA template, extension by a DNA polymerase using deoxyribonucleotides b) denaturation of a DNA template , annealing of forward and reverse primers, extension by a DNA polymerase...
Now. you should be able to answer the following questions: • How the amplification will be...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS WELL. THANKSSSSSSS 1. You want...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
Microbiology 260 please help and thank you question #1 1. suppose that a host bacterial cell...
Microbiology 260 please help and thank you question #1 1. suppose that a host bacterial cell is infected with a latent bacteriophage. Suppose also that the host cell produces an abnormally HIGH amount of Rec A. Explain HOW or IF and WHY this would affect the bacteriophage’s ability to become lytic? question #2 has two parts. 2. consider what has to occur in order for the process of transcriptiom to begin in bacterial cells. A). Besides polymerase name two other...
please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
*Microbiology. Please answer the below two multiple choice
questions. The current selected answers are incorrect. Thank you,
will provide positive feedback for correct answers!
Incorrect Question 3 0/1 pts The replication fork has both leading (continuous) and lagging (discontinuous) synthesis because: a. The origin of replication only allows DNA synthesis to occur in one direction around the chromosome. b. Primase only works on the leading strand c. Helicase is slow in unwinding the double helix so the polymerization moving toward...
please answer this question
with a correct and concise explanation, thank you so much!
1 QUESTION 6 What is the difference in the contents of a PCR reaction vs a sequencing reactions? a. Presence of DNA polymerase vs RNA polymerase b. Primers C. ddNTPs d. Template DNA e. dNTPs
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
QUESTION 8 List the components used in PCR versus the components used in qPCR. QUESTION 1 Which of the following is not valid about how Primers work for PCR Having a sequence that anneals in the range of 56°C to 60°C depending upon design. Having the same sequence as the 'template DNA' in the gene of interest, about 20-30bp in length. Using sequences that are as close to 50% GC vs AT as possible. Using a sequence complementary to the...
NEED HELP WITH THESE QUESTIONS. PLEASE ANSWER ALL AND EXPLAIN AS
WELL. THANKSSSSSSS
1. You want to clone a gene from a donor vector to a host vector. List the correct order of events in the process of cloning a. Perform ligation reaction of cloned gene and host vector. b. Perform double digestion of both donor and host vectors with the 2 restriction enzymes c. Examine donor and host vectors for restriction sites d. Purify cloned gene from donor vector...
0/5 pts Incorrect Question 15 The sequence below represents a middle section of the template strand of DNA of a structural gene in an eukaryote organism. Please fill in the blanks that correspond. The consensus sequences that the spliceosome recognizes are marked in red. The intron(s) are marked in lowercase. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. DNA: 3CATGGACAGgtaagaatacaacacagGTCGGCATGACG5 GUACCUGU cauuuuauguuguguCCAGCCGUACUGC What would be...
please help with all 3
Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago