Imagine you are the enzyme that transcirbes RNA & write the complementary RNA sequence.
Imagine you are the enzyme that transcirbes RNA & write the complementary RNA sequence. This is the DNA template.
Homework Answers
The enzyme that transcribes the rRNA is RNA polymerase 1, which is found commonly in the higher eukaryotes, this is polymerase which only transcribes the ribosomal RNA.
The RNA sequence for the complementary region is as follow:
The RNA polymerase would initiate the polymerization reaction,
ACCATCAGTC is the sequence of the DNA template sequence that would be used by RNA polymerase to sequence and create the following sequence TGGTAGTCAG. The below picture shows the evidence of the process.
Add Answer to:
Imagine you are the enzyme that transcirbes RNA & write the complementary RNA sequence.
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence...
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
What does the enzyme reverse transcriptase do? A) Using the amino acid sequence of a protein...
What does the enzyme reverse transcriptase do? A) Using the amino acid sequence of a protein as a template, it makes an RNA molecule. B) Using RNA as a template, it makes a DNA molecule. C) Using RNA as a template, it makes an RNA molecule. D) Using DNA as a template, it makes an RNA molecule. E) Using DNA as a template, it makes a DNA molecule.
Write the base sequence of the complementary strand... (Please explain! thank you) 8. Base Sequence of...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
Which enzyme lays down the signal for DNA polymerase to bind and start creating the complementary...
Which enzyme lays down the signal for DNA polymerase to bind and start creating the complementary strand of DNA? Which enzyme helps relieve tension in the DNA strand as it is pulled apart for replication? What specific structure is needed in order for DNA polymerase to start DNA replication? Select one: a. RNA primer b. DNA primer c. DNA polymerase d. nucleic acid e. nucleotide sequence Which of these is unique to the lagging strand of DNA? Select one: a....
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary...
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary RNA sequence: Write the 3-letter amino acid sequence:
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of...
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of the template DNA strand. B. The sequence of the RNA strand is transferred to the DNA. C. RNA is synthesized using a template DNA strand. D. A double stranded RNA is synthesized using a single stranded RNA.
Matching the normal function to the enzyme. This enzyme connects Okazaki fragments by forming bonds in...
Matching the normal function to the enzyme. This enzyme connects Okazaki fragments by forming bonds in the A. DNA backbone. Topoisomerase This enzyme opens the DNA helix, separating the strands to expose B. the bases. Primase This enzyme relaxes supercoils in the DNA that form ahead of the replication fork Helicase DNA Polymerase III This enzyme removes primers by cutting out one RNA nucleotide at a D. time and replacing it with DNA. DNA Polymerase This enzyme uses its own...
Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the...
Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence (make sure to indicate 5' and 3' ends): (5')ATCGTACCGTTA(3')
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand....
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid:
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Write the base sequence of the complementary strand... (Please
explain! thank you)
8. Base Sequence of Complementary DNA Strands Write the base sequence of the complementary strand (from 5' to 3') for the following one strand of a double-helical DNA, and then identify Palindrome sequence(s) or Mirror repeat sequence(s). i) 5'- GCGCAATATTTCTAGAAATATTGCGC - 3' ii) 5'-TTAGCACGTGCTAA-3' iii) 5'-TTAGCACCACGATT-3'
7 112 points). Given this DNA sequence: TAC AGT TTA ACA TCT ACT Write the complementary RNA sequence: Write the 3-letter amino acid sequence:
Matching the normal function to the enzyme. This enzyme connects Okazaki fragments by forming bonds in the A. DNA backbone. Topoisomerase This enzyme opens the DNA helix, separating the strands to expose B. the bases. Primase This enzyme relaxes supercoils in the DNA that form ahead of the replication fork Helicase DNA Polymerase III This enzyme removes primers by cutting out one RNA nucleotide at a D. time and replacing it with DNA. DNA Polymerase This enzyme uses its own...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago